ID: 1019200132

View in Genome Browser
Species Human (GRCh38)
Location 6:170307134-170307156
Sequence GGTCAGAGGTGACCTCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019200132_1019200142 27 Left 1019200132 6:170307134-170307156 CCATCTTGAGGTCACCTCTGACC 0: 1
1: 0
2: 2
3: 9
4: 205
Right 1019200142 6:170307184-170307206 TGGCTCCTATATGTCATTTTTGG No data
1019200132_1019200139 7 Left 1019200132 6:170307134-170307156 CCATCTTGAGGTCACCTCTGACC 0: 1
1: 0
2: 2
3: 9
4: 205
Right 1019200139 6:170307164-170307186 CCTCCCTTAAGATGTGTGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 133
1019200132_1019200143 28 Left 1019200132 6:170307134-170307156 CCATCTTGAGGTCACCTCTGACC 0: 1
1: 0
2: 2
3: 9
4: 205
Right 1019200143 6:170307185-170307207 GGCTCCTATATGTCATTTTTGGG 0: 1
1: 0
2: 2
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019200132 Original CRISPR GGTCAGAGGTGACCTCAAGA TGG (reversed) Intronic
900142998 1:1146295-1146317 GGCCAGAGGTGGCCACAGGAAGG - Intergenic
901144990 1:7058663-7058685 TGTCAGAGGTGACGTCTGGATGG + Intronic
901289897 1:8115885-8115907 GGTCAGAGCTCACCCCGAGAGGG - Intergenic
902167018 1:14580760-14580782 GGTCAAAGGTGACTGCAAGAAGG - Intergenic
902305045 1:15530532-15530554 GGACAGAGGTGACTCCAAGCTGG + Intronic
903926331 1:26833430-26833452 GGTCAGGGGAGACCTCTAGGAGG + Intronic
904366619 1:30014953-30014975 GATCAGAGGTGAGCTCAGAAGGG + Intergenic
904871608 1:33622552-33622574 GGTCAGAGTTATCCTGAAGATGG - Intronic
905221406 1:36450510-36450532 GGTGGGAGGTGCCCTGAAGACGG + Intergenic
905831928 1:41076245-41076267 GGTCAGAGAAGTCCTCAATAAGG - Intronic
906269173 1:44460877-44460899 GGTCAGAGGAGACCTTCTGAGGG + Intronic
909599004 1:77441722-77441744 TGTCAGACCTGACATCAAGAAGG - Intronic
909634188 1:77796947-77796969 GGTCAGAGGTGACCACAAAGGGG - Intronic
911902235 1:103521437-103521459 GGTCACTGATGACCTCGAGAAGG + Intergenic
912258527 1:108085543-108085565 GACCAGTGGTGGCCTCAAGAAGG + Intergenic
912509981 1:110182778-110182800 GGTCACTAGTGACCTCAACAAGG + Intronic
917446925 1:175114462-175114484 TGTCAGACCTGACCCCAAGAGGG - Intronic
917695649 1:177520541-177520563 GGCCATAGCTGACCTCTAGATGG - Intergenic
918095412 1:181330210-181330232 GGTCAGGGGTGAGCTCAGGAAGG - Intergenic
920779416 1:208974159-208974181 AGTTAGAGGTGACATCAAAATGG + Intergenic
1063518804 10:6722416-6722438 GGTTAGAAGTGTGCTCAAGAAGG + Intergenic
1064271039 10:13866339-13866361 GGTCAGAGGTCAGATCATGAGGG - Intronic
1065404539 10:25349284-25349306 GATCACAGGTGTCCTCATGAAGG - Intronic
1066684798 10:37970686-37970708 GGTAAGAGGTAACATCAAAAAGG - Intronic
1070091768 10:73293680-73293702 GGTCAGAGGTGACCTGCATAGGG - Intronic
1070401716 10:76058747-76058769 GGTCAGAGGAGTCTTCATGAAGG + Exonic
1070596408 10:77835716-77835738 GGTATGGGGTGACCTCAAGCTGG - Exonic
1071465414 10:85935304-85935326 GGTGAGAGGTCACCTGAAGAAGG + Intronic
1075778825 10:125004151-125004173 GGGCAGGGGTGACCCCAGGAAGG + Intronic
1080786348 11:35478438-35478460 GGGCAGAGTTGGCCCCAAGATGG + Intronic
1081476928 11:43442607-43442629 GCTTAGAGGAGAACTCAAGAGGG + Intronic
1081626808 11:44660975-44660997 GCACAGATGTGAGCTCAAGAGGG - Intergenic
1084983783 11:72849472-72849494 GGTTATGGGTGACCTTAAGAAGG + Intronic
1090397626 11:126429615-126429637 GGTCAGAGAAGACTTCTAGAAGG - Intronic
1092256556 12:6929046-6929068 GGTCAGAGGTGACCTGCAGTAGG - Intronic
1092968032 12:13664082-13664104 GGGCAGAGGTGACCAAAATATGG + Intronic
1096972575 12:55679692-55679714 GATCAGCGGTTACCTGAAGATGG + Intergenic
1098457463 12:70691202-70691224 GGTCAGTGGTGACCTTAGCAAGG - Intronic
1098795664 12:74885951-74885973 TTTTAGAGGTGACATCAAGAGGG + Intergenic
1100391717 12:94149997-94150019 GGTCAGCTGGGACTTCAAGACGG + Exonic
1102871339 12:116416502-116416524 TGTCAGAGCTGACCACAAAAGGG - Intergenic
1106845489 13:33733895-33733917 GGTAAAAGGTGACGTGAAGACGG + Intergenic
1107265188 13:38545566-38545588 GGTCCGTGGGGACTTCAAGAAGG - Intergenic
1109212448 13:59549199-59549221 TGTCAGACTTGACATCAAGAAGG + Intergenic
1110572719 13:77024055-77024077 TGACAGAGGTGACAGCAAGAAGG + Intronic
1111006567 13:82257795-82257817 GGTGAGAGGTGACAGCATGATGG + Intergenic
1112250865 13:97778912-97778934 GGTCAAAAGTGAAATCAAGATGG - Intergenic
1112651649 13:101405597-101405619 CGTGAGAGGTGACCTCATGGAGG - Intronic
1112812011 13:103229533-103229555 TGGAAGAGGTGTCCTCAAGAGGG - Intergenic
1113771349 13:112911237-112911259 GGTCAGAGGTGATGGCCAGAGGG + Intronic
1115474187 14:33798561-33798583 GAGCACAGGTGCCCTCAAGAAGG - Intronic
1115927781 14:38456262-38456284 GGTAAGAGATGACCTCCACATGG - Intergenic
1117063190 14:51983413-51983435 GGTCAGAGGAGGCCTCATGGAGG - Intergenic
1117271601 14:54149473-54149495 GGTCAGCAGTGAAATCAAGATGG + Intergenic
1119195809 14:72715898-72715920 ACTCAGAGTTGACCCCAAGAAGG + Intronic
1120399186 14:84006724-84006746 GGTCAGAAGTGACCCCTAGTGGG - Intergenic
1120489839 14:85163418-85163440 GGTCAAAAGTGAAATCAAGATGG + Intergenic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1121220969 14:92285152-92285174 GTTCAGGAGTGGCCTCAAGATGG - Intergenic
1121892369 14:97606467-97606489 GGTCACTGGTTACCTCCAGAGGG - Intergenic
1122236739 14:100334994-100335016 GCTCACCGGTGAGCTCAAGAAGG - Exonic
1124209939 15:27754286-27754308 TGTCACAGGTGCCCTCAGGATGG - Intergenic
1126085184 15:45004729-45004751 GGTCAGAGGTGAAATCATAAAGG - Intergenic
1127841660 15:62837194-62837216 GGTCAGAGAGGGACTCAAGAGGG - Intronic
1131018534 15:89078065-89078087 GGTCAGAGATGATCCCAAGGTGG - Intergenic
1131050703 15:89346095-89346117 AGTCAGAGGGGCCCTCAAGTGGG - Intergenic
1132645981 16:999492-999514 GGTCAGTTGTGACCTCACGGAGG - Intergenic
1133548095 16:6827658-6827680 GATCAGAAGAGACCTCAAAAGGG - Intronic
1134559126 16:15192626-15192648 GGTCAGAGGTGTAGTCAAAAAGG - Intergenic
1134919662 16:18104239-18104261 GGTCAGAGGTGTAGTCAAAAAGG - Intergenic
1137246585 16:46711017-46711039 GGAAAGAGGTGAGCACAAGAGGG - Intronic
1137372159 16:47917615-47917637 GGTCAGAAGAGAGCTCAACATGG + Intergenic
1137535371 16:49318820-49318842 GGTCAAAGATGAACTCAAAAGGG - Intergenic
1137607555 16:49796678-49796700 GGTCAGAGGAGGCCTCTAGTAGG + Intronic
1137982137 16:53078960-53078982 GGTCAGAGGTTGCCTGAATATGG + Intronic
1139147655 16:64343711-64343733 GGTGAGAGGTGACAGCATGAGGG + Intergenic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1142190781 16:88716368-88716390 GGTCCGAGGTGCCCTCGAGCAGG + Exonic
1143492196 17:7290995-7291017 GGTCAGAGCTGGCCCCAGGAGGG + Intronic
1144106400 17:11990357-11990379 GATCAGAGGTTTCCTCAGGATGG + Intronic
1146050333 17:29546060-29546082 GGTTAGAGCTGACTTCAATAAGG - Exonic
1146058334 17:29592084-29592106 GTTCTGAGGTGGGCTCAAGAAGG + Intronic
1148128048 17:45246937-45246959 GGTCGGAGGTGACCTGCAGTGGG - Exonic
1148450027 17:47771062-47771084 AGTCAGAGTGGACCTAAAGAGGG - Intergenic
1152247000 17:79190085-79190107 GGAAAGAGGTGACCTCAAACAGG - Intronic
1153341764 18:3982351-3982373 AGTCAAAGGTGATCTGAAGAAGG - Intronic
1153505537 18:5793577-5793599 GGTCAGAGGTCCCCTGTAGAAGG - Intergenic
1155154728 18:23148720-23148742 GGTCAGCTGTGACCTCACGGTGG + Intronic
1159568691 18:70086745-70086767 TTTCAGAGATGACCACAAGATGG - Intronic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1163566159 19:18052349-18052371 GGGGAGAGGTGCCCGCAAGAGGG + Intergenic
1165145744 19:33728885-33728907 GGACAGAGGTGAGCTCCATAGGG + Intronic
1165530295 19:36393933-36393955 GGACAGGAGAGACCTCAAGAAGG - Exonic
1166279030 19:41777991-41778013 GGAGAGCAGTGACCTCAAGAAGG + Intergenic
1167050657 19:47075893-47075915 GGACAGAGGTGCCCTCCACAGGG - Intronic
1167220174 19:48194226-48194248 GGTCTGAGGTGGCCCCGAGAAGG + Intronic
1167256243 19:48431188-48431210 GGTGAAAGGTGATCCCAAGATGG - Intronic
1167667787 19:50832790-50832812 GGTCAGAGAAGGCCTCAAGGAGG - Intronic
931482392 2:62654662-62654684 GGCCTGAGGTGACCTCACCAAGG - Intergenic
932105139 2:68935399-68935421 GGTCTGGGGTGGCCTCAAGGTGG + Intergenic
934070181 2:88376760-88376782 GCTCAGAGGTCACCACAATAGGG - Intergenic
934715886 2:96543061-96543083 GGTCAGAGGCTAGCCCAAGAGGG + Intronic
936555153 2:113490262-113490284 GGTCAAAGATGAAATCAAGATGG + Intronic
939826248 2:147018884-147018906 GCTCAGAGGTGACCACAGCAGGG - Intergenic
940157042 2:150668234-150668256 GGTCAGAAATGAAATCAAGATGG + Intergenic
941702353 2:168617137-168617159 GGTCAGAAATGAAATCAAGACGG + Intronic
943952533 2:194148607-194148629 AGTGAGAGGGGACCTGAAGACGG + Intergenic
944402893 2:199348751-199348773 AGTCAGAGATGAGCTGAAGAGGG - Exonic
948902605 2:240964031-240964053 GGTCACAGGTGGCCTCCAGGAGG + Intronic
1171329503 20:24325259-24325281 AGTCAGGGGAGACTTCAAGAAGG + Intergenic
1173181275 20:40808063-40808085 GGTCAGGAGGAACCTCAAGAAGG - Intergenic
1173465136 20:43274641-43274663 GGAGAGAGGAGACTTCAAGATGG - Intergenic
1173759120 20:45544476-45544498 GGTAAGAGTTGAACTCAGGATGG + Intronic
1173852180 20:46226077-46226099 GTTGAGAGGTGACGTCGAGAGGG - Intronic
1174444613 20:50582249-50582271 GGTCAGAGGTCACCACAGGGTGG + Intronic
1175073090 20:56351039-56351061 GGTCAGAGTTGCCTTCCAGAGGG - Intergenic
1175573335 20:60040640-60040662 TGTCACAGGTGACCTGCAGAAGG + Intergenic
1177319853 21:19507901-19507923 TGTCAGAACTGACATCAAGAGGG - Intergenic
1177754871 21:25334536-25334558 GGTCAGAGATGACATCTAAAAGG + Intergenic
1178003728 21:28193092-28193114 TGTCAGAGGTAGCCACAAGAGGG + Intergenic
1179234455 21:39532952-39532974 TGACAGACGTGACCTCAAGCTGG - Intergenic
1182735339 22:32529099-32529121 GGACAGAAGTGACCACCAGATGG + Intronic
1184423393 22:44395056-44395078 GGTCAGAGCTGAGCTCAAGACGG + Intergenic
1184786366 22:46673914-46673936 GGCCAGAGGAGCCCTCAGGATGG + Intronic
950177654 3:10886478-10886500 GGTCAGAGGTGACCTGACTTTGG - Intronic
951485125 3:23202702-23202724 GGTTAGGGGTTACCCCAAGACGG - Intergenic
951946114 3:28138345-28138367 GGCCTGAGGTTATCTCAAGATGG + Intergenic
952845186 3:37682300-37682322 GGTCACCAGTGACCTCCAGAAGG + Intronic
954227472 3:49191580-49191602 CTCCAGGGGTGACCTCAAGATGG + Intronic
954451242 3:50572842-50572864 GGTCAGAGGGGAGTCCAAGAAGG - Intronic
957690514 3:83559882-83559904 GGTGACAGGTGTCCTCCAGAGGG + Intergenic
957826716 3:85456064-85456086 GGTCAGAGGTTACCTTTAAATGG + Intronic
958770912 3:98424461-98424483 GGTCAAAAGTGAAATCAAGATGG + Intergenic
959484326 3:106909265-106909287 GTTCAGAGGAGACCTGCAGAGGG - Intergenic
960631613 3:119737853-119737875 TGCCAGAGGTGTCATCAAGACGG + Intronic
962380514 3:134894773-134894795 GATCAGAGGTGACCACGAGGAGG - Intronic
963008820 3:140750560-140750582 GGGCAGAGCTGAGCTCAGGAAGG + Intergenic
963285008 3:143425889-143425911 GGTCAGAGTTCAGCTCCAGATGG - Intronic
964924158 3:161935819-161935841 GGTCAGATGTGACGTGATGATGG + Intergenic
966003553 3:174980109-174980131 GATCAGAGGTGGCCTCCAGAAGG - Intronic
967209329 3:187153042-187153064 GGTCAGAAATGAAATCAAGATGG + Intronic
967261205 3:187644289-187644311 GGTCAATGATGATCTCAAGATGG - Intergenic
968518984 4:1027287-1027309 GGTCAGAGGTGACCTGAGCCTGG - Intergenic
968595351 4:1479425-1479447 GGTAAGAGGTGCCCTAAATAGGG - Intergenic
968853056 4:3096615-3096637 GGTCAGAAGTGAAGTCAAAAGGG + Intronic
968966715 4:3772579-3772601 GGACAACGGGGACCTCAAGATGG - Intergenic
971045123 4:22797683-22797705 GGTGAGTGGTGTCCTCCAGAGGG + Intergenic
971368420 4:25995664-25995686 GGTCAGGGGTGACCTGGAAATGG - Intergenic
972408236 4:38766483-38766505 GGTCAGAGGTCATCTCAAAGGGG + Intergenic
973244278 4:47993914-47993936 GGTCAAAAGTGAAATCAAGATGG - Intronic
976005944 4:80431000-80431022 GGTCAGAGGAGGTCTCACGAAGG - Intronic
976464912 4:85355968-85355990 GGTCAGTAATGACATCAAGATGG - Intergenic
979188980 4:117833976-117833998 GGACAGACTTGACCTCAGGAAGG - Intergenic
982119364 4:152126574-152126596 GGTCAGAAATGAAATCAAGATGG - Intergenic
984950406 4:185003767-185003789 GGTCAGAAGTGACCTCGAGAGGG - Intergenic
986495017 5:8332857-8332879 GGTCAGCGGTGAACACAAGGTGG + Intergenic
986688774 5:10296816-10296838 GGTCATTGGTGACCTCCACAAGG + Intronic
987033117 5:13994041-13994063 GGTCAGAGGTGAGCAGAGGACGG - Intergenic
987230777 5:15891687-15891709 GCTCAGAGGTCACCTCCAGAGGG - Intronic
992373586 5:76169904-76169926 GGTCAGAGATGTCTTCTAGAGGG + Intronic
994084351 5:95742333-95742355 AGTCAGAGGCTACCTCATGAAGG - Intronic
995399856 5:111728711-111728733 GGTCACATGAGACCTCTAGAAGG + Intronic
997565974 5:134886685-134886707 TGTCAGAGGCCACCTCAGGAAGG + Intronic
998157314 5:139794529-139794551 GGTCAGAGAAGACTTCATGAAGG + Intergenic
1002761234 6:203985-204007 GCTCAGACGTCACCTCCAGAAGG + Intergenic
1006004252 6:30989836-30989858 TGTCTGAGGTGGCCACAAGATGG - Exonic
1006717134 6:36127822-36127844 GGGCAGAGGTGAGCCCAGGAAGG - Intronic
1007379990 6:41483057-41483079 GGCCAGAGCTGAGCTCAACATGG - Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1008115765 6:47547930-47547952 GGTCAGAAATGAAATCAAGATGG + Intronic
1008770109 6:54967955-54967977 GGTCAGAGATGACTTGAAAATGG + Intergenic
1011195534 6:84775151-84775173 GCTCAGAAGCGACCTAAAGAAGG + Intergenic
1011553703 6:88552669-88552691 GGTCAGAGAAGACGTCAAGCAGG - Intergenic
1013852396 6:114532171-114532193 GGTCAAAAGTGAAATCAAGATGG - Intergenic
1018656430 6:166041446-166041468 GGTCAGAGGTGAAGGCCAGAGGG + Intergenic
1019200132 6:170307134-170307156 GGTCAGAGGTGACCTCAAGATGG - Intronic
1019997342 7:4733337-4733359 GGTCATAGCTGACATTAAGATGG - Intronic
1020586829 7:10079345-10079367 GCTCAGAGGAGACCTGCAGATGG - Intergenic
1021633053 7:22665310-22665332 GGTCCGAGGTGAGCTAAGGAAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1031386687 7:121160520-121160542 GCTTAGAGATGACTTCAAGAGGG + Intronic
1034830598 7:154304845-154304867 GGGCAGAGGTGGCCCCAGGAGGG - Intronic
1034929015 7:155145681-155145703 GATCACAGGTGACAGCAAGACGG - Intergenic
1035454099 7:158997740-158997762 GGTCAGAGCTAACCCCAGGAAGG - Intergenic
1039026662 8:33266176-33266198 GGTCAGAGGTTGCCTAGAGAAGG + Intergenic
1040809369 8:51434331-51434353 GGTCAGGGGATACCTCTAGAAGG - Intronic
1042100462 8:65270843-65270865 GGTCAGTAGAGACCTCAAGGGGG + Intergenic
1042637369 8:70893772-70893794 TGTCAGACCTGACATCAAGATGG - Intergenic
1043734177 8:83723804-83723826 AGTCAGAGGTGACCCAAAGTGGG + Intergenic
1044725393 8:95190708-95190730 GGTGTGAGGAGAGCTCAAGAGGG - Intergenic
1046634029 8:116652097-116652119 GGACAGAGATGAGCACAAGAGGG + Intronic
1046721057 8:117619606-117619628 GCTCAGAGGTGATGTCAAGTAGG - Intergenic
1048748671 8:137645703-137645725 GAGCAGAGGTGACCTACAGAGGG - Intergenic
1048901234 8:139039821-139039843 CAGCAGAGGTGACCTCCAGAGGG - Intergenic
1049219598 8:141422812-141422834 GGTCAGCGCTGACCACAGGAGGG + Intronic
1049897851 9:126920-126942 GGTCAAAGATGAAATCAAGATGG - Intronic
1051817816 9:21130487-21130509 GATCAGTGGTGGCCTAAAGATGG + Intergenic
1052137544 9:24932972-24932994 AATCAAATGTGACCTCAAGAAGG - Intergenic
1052273338 9:26651144-26651166 GGTCAGAGATGAGTTCTAGAAGG - Intergenic
1053284220 9:36840003-36840025 GCTCAGAGCTGTCCTCAAGATGG - Exonic
1053740934 9:41137213-41137235 GGTCAAAGATGAAATCAAGATGG - Intronic
1054443922 9:65293355-65293377 GGTCAAAGATGAAATCAAGATGG - Intergenic
1054486351 9:65728151-65728173 GGTCAAAGATGAAATCAAGATGG + Intronic
1054687417 9:68294084-68294106 GGTCAAAGATGAAATCAAGATGG + Intronic
1055264749 9:74481822-74481844 GGTCCTTGGTGACCTCTAGAGGG - Intergenic
1055422201 9:76155770-76155792 GGTCAGAGAGTACTTCAAGAAGG + Intronic
1055890865 9:81122409-81122431 GCTCAGAGGTGACCTGCAGTGGG + Intergenic
1056462198 9:86818762-86818784 GCTCAGAGGAGACCTGGAGATGG - Intergenic
1057046490 9:91890085-91890107 GGTCAGAGGTGTTCTTAGGATGG + Intronic
1058622948 9:106903162-106903184 GGTCAAAAATGACATCAAGATGG - Intronic
1061394879 9:130338326-130338348 GGTCAGAGGGGAACCCATGAAGG + Intronic
1061936496 9:133860585-133860607 GGGCACAGGTGACATCATGAGGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1187317168 X:18206850-18206872 GGACGGAGGTGGACTCAAGAGGG + Intronic
1188547942 X:31330438-31330460 GATCACTGGTGACCTCAAAAGGG + Intronic
1197476074 X:126927201-126927223 GGTCAAAGATGAAATCAAGATGG - Intergenic
1198111945 X:133509663-133509685 GGGCAGAGGAGACCCTAAGAGGG + Intergenic