ID: 1019202128

View in Genome Browser
Species Human (GRCh38)
Location 6:170326592-170326614
Sequence GTTGTGACGGGGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019202128 Original CRISPR GTTGTGACGGGGACTGTGGA AGG (reversed) Intronic
900780525 1:4614791-4614813 GCAGTGACGGGCCCTGTGGAGGG + Intergenic
902351556 1:15859504-15859526 GTGGTGGCGGGGGCTGTGGCGGG - Intronic
902655603 1:17865933-17865955 GTTGTAACGGGGAGAGTGGGCGG - Intergenic
902973510 1:20072136-20072158 ATGGGGACGGGGACTGTTGATGG - Intronic
903015601 1:20359670-20359692 GGTGTGCCGGGGACTGAGGAAGG + Intergenic
903649440 1:24913917-24913939 GATGTGCCGGGCACTGTGCAAGG + Intronic
904309119 1:29614287-29614309 GTTGTCACTGTGTCTGTGGATGG - Intergenic
904559415 1:31386718-31386740 GATGTGTCTGGGAGTGTGGATGG - Intergenic
905473504 1:38209841-38209863 GAGGTGGCGGGGACTGTGGAAGG + Intergenic
906280517 1:44550184-44550206 TTTGCCAAGGGGACTGTGGAGGG - Intronic
907650359 1:56288917-56288939 GGTTTGACTGGGACTCTGGAAGG - Intergenic
912495593 1:110089404-110089426 GTTGAGCCTGGGACTCTGGAGGG + Intergenic
913317814 1:117567314-117567336 GTTGAGGTGGGGAGTGTGGAAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914242386 1:145860330-145860352 GTTGGGATGGGGCCTCTGGAGGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915267868 1:154731723-154731745 GGTGTGAGGGGGGCTGTGGACGG + Intronic
916442448 1:164841003-164841025 GATGTGTCGGGCACTGTGGTGGG + Intronic
916607748 1:166359631-166359653 GCTGCAAAGGGGACTGTGGATGG - Intergenic
917251645 1:173069248-173069270 GTGGTGTGGGGGACGGTGGAGGG - Intergenic
917443151 1:175084357-175084379 GTTGTGTTGGGGGATGTGGAGGG + Intronic
918796731 1:188908069-188908091 TTTGTGACGTGGATTGTTGATGG - Intergenic
920542036 1:206785998-206786020 GTGGTGACGGGGACTTGGGGTGG + Intergenic
1062963469 10:1590765-1590787 GGTGTGAGGTGGACGGTGGACGG + Intronic
1064104744 10:12491484-12491506 GTTGTGAGGGGGTGGGTGGATGG + Intronic
1067850162 10:49749659-49749681 TTTGGGAGGTGGACTGTGGAGGG - Intronic
1069409283 10:68135940-68135962 GTTGGGATAGGGACTTTGGAAGG + Intronic
1069867353 10:71511984-71512006 GTTGGGATGGGAACAGTGGAAGG + Intronic
1071056969 10:81522814-81522836 GTTTTGACAGGGGCTGTGAAGGG + Intergenic
1071496427 10:86170444-86170466 TTTGTGATGGGGCCTATGGAGGG - Intronic
1075486227 10:122823721-122823743 GTTGGGATTGGGGCTGTGGAGGG - Intergenic
1075870128 10:125766230-125766252 ATTCTGACAGGGACTGTGGAGGG + Intergenic
1076109892 10:127852144-127852166 GCTGTGACGGGGGCCCTGGAGGG + Intergenic
1078421062 11:11213418-11213440 GATGACAAGGGGACTGTGGAGGG - Intergenic
1079422159 11:20303731-20303753 GTTGAGACAGGGACTGGGAATGG + Intergenic
1080749067 11:35136095-35136117 GTTGGGATGGGGCCTGGGGAGGG + Intergenic
1080959735 11:37145023-37145045 GTTGTGGGAGGGACTGTGGTGGG - Intergenic
1083682022 11:64355628-64355650 GGTGAGTGGGGGACTGTGGAAGG + Exonic
1085392778 11:76190964-76190986 GCTGTGACTGGGGCTGTGGTAGG + Intronic
1090226878 11:125076997-125077019 GCTGTGTCGGTGGCTGTGGATGG + Intronic
1093863086 12:24191677-24191699 GTTGTCACTGGGACAATGGAAGG - Intergenic
1096183067 12:49561315-49561337 GAAGTGAGGGGGAGTGTGGAGGG + Intronic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1098358086 12:69629827-69629849 GATGTGATGGGGGCTTTGGAAGG - Intergenic
1100162319 12:91874775-91874797 GTTCTGACAGGGCCTATGGAGGG + Intergenic
1101916443 12:108899730-108899752 GGTGTGACTGGGAGTGGGGATGG + Intronic
1112105162 13:96232022-96232044 GTTCTGAAGGGGAGTGTGGTAGG + Intronic
1112260100 13:97869826-97869848 GTTGTGACAGTCACTGAGGATGG + Intergenic
1113716043 13:112508553-112508575 GTTGTGGAGTGGAATGTGGAAGG - Intronic
1117069492 14:52043786-52043808 GGTGTGGCGGGGGTTGTGGATGG + Intronic
1117713527 14:58557357-58557379 ATTGTGAGGTGGACAGTGGAAGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1122300405 14:100728063-100728085 GCGGGGACGGGGACCGTGGAGGG - Intronic
1123105737 14:105840322-105840344 GTTGGGACGGGGACTCTGAGGGG - Intergenic
1125536831 15:40445833-40445855 ATTGTGCTGGGGACTTTGGAGGG + Intronic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1129219402 15:74122781-74122803 GCTTTGATGGGGACAGTGGAGGG + Intronic
1129759969 15:78123657-78123679 GTTGGGACTGGGACTGGGGCCGG - Intronic
1129972466 15:79790908-79790930 GTTGGGACTGAGACTGTGGATGG - Intergenic
1132350565 15:101137247-101137269 GATGTGATGGGGACTGAGCAGGG + Intergenic
1134996155 16:18740216-18740238 GATGTGGCGGGGCCTGTGGGAGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137362308 16:47829827-47829849 GTTGTGATGGAAACTGTAGAGGG + Intergenic
1141771067 16:86089909-86089931 GCTGAGAAGAGGACTGTGGAGGG - Intergenic
1142074593 16:88110196-88110218 GTTCTGACGGGTACTGGGGTGGG - Intronic
1142217248 16:88835902-88835924 GTGGGGACGGGGACCGTGGGAGG - Intronic
1203050829 16_KI270728v1_random:873634-873656 GTTGTGTTGGGGCCTGTGGGAGG - Intergenic
1146841303 17:36156972-36156994 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1146853554 17:36244609-36244631 GAGAAGACGGGGACTGTGGAAGG + Intronic
1146869463 17:36368501-36368523 GAGAAGACGGGGACTGTGGAAGG + Intronic
1147072338 17:37969125-37969147 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1147083862 17:38048662-38048684 GAGAAGACGGGGACTGTGGAAGG + Intronic
1147099808 17:38172629-38172651 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1150082816 17:62255919-62255941 GAGAAGACGGGGACTGTGGAAGG + Intergenic
1150833130 17:68541266-68541288 TTGGTGAGAGGGACTGTGGAGGG - Intronic
1151926356 17:77200423-77200445 GTTGTGAAGGGAACTTTGGGAGG - Intronic
1153115193 18:1646316-1646338 GTTGTGGCGGGGAGTGGGGAAGG + Intergenic
1153271836 18:3330065-3330087 GCTGTGAGAGGGACTGTGCAAGG + Intergenic
1154177442 18:12094434-12094456 GTTGGGTGGGGGACTGTGGTAGG + Intronic
1155779391 18:29811815-29811837 GTTGTGGCAGGGACTGTGCATGG - Intergenic
1162174770 19:8822902-8822924 GTTGTGTTGGGGACAGAGGAAGG - Intronic
1162726783 19:12694777-12694799 GGTGAGACGGGGTCTGTGGGGGG - Exonic
1164601573 19:29566670-29566692 GGTGTGATGGGCACTGAGGAGGG + Intergenic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1167781641 19:51602240-51602262 ATCGTGACGGGGGCTGTGAATGG - Intergenic
1168682404 19:58325663-58325685 GTTGTTACGGTGACTGTGAATGG - Intergenic
928375412 2:30769532-30769554 GTTGTGTGCAGGACTGTGGATGG - Intronic
928416683 2:31098521-31098543 GTTGTGACATGAACTGGGGATGG - Intronic
929546411 2:42857633-42857655 TTTGTGTCGGGGACTAGGGAGGG - Intergenic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
933595794 2:84282255-84282277 GGTGTGACGGGGAATGAGGCCGG + Intergenic
935205723 2:100895278-100895300 TTTGTGCCGGGGACTGTGCTGGG + Intronic
938101032 2:128498382-128498404 GTTCTCATCGGGACTGTGGAGGG - Intergenic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
944209260 2:197189454-197189476 GTAGTTAGGGGGAGTGTGGAAGG - Intronic
946338556 2:219054611-219054633 GTAGTGCCGGGGACTGGGGGAGG - Exonic
948125294 2:235560572-235560594 GGAGAGTCGGGGACTGTGGAAGG + Intronic
949025141 2:241764199-241764221 GGGGCGACGGGGACTGTGGGAGG + Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1170520445 20:17179759-17179781 GTGGTGGTGGGGGCTGTGGAAGG - Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1173913271 20:46686876-46686898 GTTGGGATGGGTACTGAGGAAGG + Exonic
1174137956 20:48393419-48393441 GTGGTGATGGGGTCTGTGGACGG + Intergenic
1175094733 20:56532341-56532363 GGAGTGGTGGGGACTGTGGAGGG + Intergenic
1175404797 20:58719005-58719027 GTTCTGGTGGGGGCTGTGGATGG - Intronic
1175915104 20:62422552-62422574 GTGGGGACGGGGACTGGGGTGGG + Intronic
1175915120 20:62422588-62422610 GTGGGGACGGGGACTGGGGTGGG + Intronic
1176071565 20:63229413-63229435 GGGGAGACGGGGAGTGTGGACGG - Intergenic
1176411816 21:6453326-6453348 GTGGTGACAGGGAAAGTGGAAGG - Intergenic
1177410149 21:20719035-20719057 TTTATGATGGAGACTGTGGATGG + Intergenic
1179687310 21:43061648-43061670 GTGGTGACAGGGAAAGTGGAAGG - Intronic
1179908054 21:44434345-44434367 ATGGTGACGGGGACTGTGGCGGG + Intronic
1181094677 22:20496912-20496934 GTTTTGAGAGGGACTGTGAAGGG + Intronic
1181748959 22:24975947-24975969 ATAGTGGCGGGGAGTGTGGATGG - Intronic
1183010241 22:34940334-34940356 TTTGTGCCGAGGGCTGTGGAAGG + Intergenic
1184757324 22:46524426-46524448 GTTGTCATGGGGATTGTGCAGGG - Intronic
1185043100 22:48515715-48515737 GGCGGGACGGGGAGTGTGGAGGG + Intronic
1185094963 22:48801060-48801082 GTTGGGCCAGGGACTGAGGAGGG + Intronic
1185388674 22:50547837-50547859 GTTGGGACTGGGACTGGGGCTGG - Intergenic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
958165888 3:89877387-89877409 GCAGGGACGGGGGCTGTGGATGG + Intergenic
962254031 3:133858140-133858162 CCAGTGACTGGGACTGTGGAAGG - Intronic
963074668 3:141334690-141334712 GTGGTGCCGGGGGCTGGGGAAGG - Intronic
966387050 3:179409939-179409961 GTTGTGAGGGAGCCGGTGGAAGG + Intronic
969413931 4:7046688-7046710 GCTGTGACTGTGAGTGTGGAAGG + Intronic
971132516 4:23828409-23828431 GTTGTGACTGCGACTGTGTGTGG + Exonic
971337636 4:25738779-25738801 GTTGTGAGAGGGACTGTGTGAGG - Intergenic
972089379 4:35260860-35260882 AGTGTGAAAGGGACTGTGGAAGG - Intergenic
975492376 4:75002999-75003021 GTTGGGACTGGGTCTGTGAAAGG + Intronic
975629289 4:76383353-76383375 ATGGTGAGGGGGTCTGTGGATGG - Intronic
978644562 4:110914862-110914884 GTTGTGACGGTGTTTGTGCATGG + Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
992602776 5:78421212-78421234 GTTGTGTGGGGGAGTGAGGAGGG + Intronic
997197719 5:131990821-131990843 GTTGTGGGGGGGGGTGTGGAGGG - Intronic
1002169216 5:177366117-177366139 GTTGTGCCAGGGGCTGGGGAAGG + Intronic
1004058390 6:12164269-12164291 GTTGTGACGTGGACGCTGGTTGG - Exonic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004498203 6:16184563-16184585 TTTGTGTCTGGGACTGTGGTAGG + Intergenic
1006603988 6:35243506-35243528 GTTGTGGCGGGGAGTGGGAAGGG + Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007101546 6:39250998-39251020 GTTATGAAGAGGACTGTGTAGGG - Intergenic
1014798684 6:125753623-125753645 GCTGTCTCGGGGACTGTGGGTGG - Intronic
1019202128 6:170326592-170326614 GTTGTGACGGGGACTGTGGAAGG - Intronic
1019771330 7:2885422-2885444 GTTTTGATGGGGACTGTGGCTGG + Intergenic
1020118078 7:5487503-5487525 GCCGTGTCGGGGACTGTGCAGGG - Intronic
1022224061 7:28345468-28345490 GTTGTGATGGGGGATGGGGATGG + Intronic
1024177340 7:46854450-46854472 GTTGTGTAGGGGGCTGAGGAGGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1029536852 7:101162416-101162438 GAGGAGACGGGGACTGTGGCTGG + Intergenic
1029967604 7:104756059-104756081 GTTGGGATGGGGAGTGGGGATGG + Intronic
1030744199 7:113145480-113145502 GTTGTGGCGGAGACAGTGGGAGG + Intergenic
1031820925 7:126500400-126500422 GTTGTTGCTGGGACTCTGGAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035538055 8:407241-407263 GTGGGGACGGGGCCTGTGGGAGG + Intronic
1036088081 8:5635545-5635567 GTTGTGGGAGGGACTGTGGGAGG - Intergenic
1038254201 8:25935454-25935476 GTTGTCAGGGGTACTGGGGAGGG + Intronic
1038529223 8:28304076-28304098 GTGCTGACAGGGACTGTGGCTGG + Intergenic
1039547514 8:38420692-38420714 GTTGGGAGGAGGCCTGTGGAAGG - Intronic
1041097269 8:54362077-54362099 GTTGTGACAGGGAGTGAGGTGGG + Intergenic
1042307335 8:67345172-67345194 GTTGTGCCAGGTACTGTTGAGGG + Intergenic
1048931972 8:139322458-139322480 GTTGAGAAAGGGACTCTGGAGGG - Intergenic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1057019261 9:91683259-91683281 GTTGTGACAGTGTCTGTGGTGGG - Intronic
1057053069 9:91940543-91940565 GGTGTCACAGGGACTGAGGATGG - Intronic
1060477713 9:123998736-123998758 GGTGTGATGGGGAATGGGGAGGG + Intergenic
1062248730 9:135583781-135583803 GATGTCACGGGGCCTGTGGACGG + Intergenic
1186927821 X:14354645-14354667 GTTGTCATGGTGACTGGGGAAGG + Intergenic
1187656563 X:21481750-21481772 GTTGTGAGAGGGCCTGTGTAGGG + Intronic
1194710843 X:97234552-97234574 CTTGTGACAGGGACTGTGTGTGG - Intronic
1195839454 X:109157140-109157162 GTTGTGATGGGGACTGTTGGAGG - Intergenic
1196462386 X:115944073-115944095 GTTGGGACTGGGACTCTGGGAGG - Intergenic
1196858738 X:120007745-120007767 CTTGTAATGGGGGCTGTGGAAGG - Intergenic
1198780708 X:140232699-140232721 GTTGGGAAGGGTACTGGGGAGGG - Intergenic
1199613358 X:149635788-149635810 TTTGTGCCGGGCACTGTGGAAGG + Intergenic