ID: 1019208885

View in Genome Browser
Species Human (GRCh38)
Location 6:170388325-170388347
Sequence TGGTGAGGCCGCGGACGAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019208885_1019208891 15 Left 1019208885 6:170388325-170388347 CCTTCTCGTCCGCGGCCTCACCA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1019208891 6:170388363-170388385 ACAGCGCATGTGGCTTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 134
1019208885_1019208890 5 Left 1019208885 6:170388325-170388347 CCTTCTCGTCCGCGGCCTCACCA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1019208890 6:170388353-170388375 GTTTTAGTCAACAGCGCATGTGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019208885 Original CRISPR TGGTGAGGCCGCGGACGAGA AGG (reversed) Exonic
910673122 1:89793097-89793119 TTGCGAGGCCGAGGCCGAGAAGG + Intronic
915234590 1:154471114-154471136 TGGTGAGCCCGCGGGCCACAGGG + Intronic
915558694 1:156674412-156674434 TGGGGAGGACGTGGAGGAGAGGG - Intronic
916777446 1:167982006-167982028 TGGTGAGGCCGCAGAGAAAAAGG - Intronic
921095347 1:211882558-211882580 TGGTGAGGCCGTGGAGAATAGGG - Intergenic
921630784 1:217431263-217431285 GGGTCAGGCCTTGGACGAGATGG - Exonic
922030102 1:221789542-221789564 TGGTGAGGCCTCTTACAAGAAGG - Intergenic
1065292287 10:24242722-24242744 TGGTGAGGCTGTGGAGGAAAGGG - Intronic
1065641762 10:27789718-27789740 TGGTGAGGATGTGGAGGAGATGG - Intergenic
1069428552 10:68312317-68312339 TGGTGAGGACGTGGAGAAGAGGG - Intronic
1078638196 11:13072086-13072108 TGGTGAGGCTGTGGAGGAAAGGG - Intergenic
1079593035 11:22204704-22204726 TGGTGAGGCTGTGGAGAAGAAGG + Intronic
1084689033 11:70714230-70714252 TGCTGAGGACACGGAGGAGAAGG + Intronic
1087085121 11:94210405-94210427 TGGTGAGGCTGCGGAGGAAAAGG + Intergenic
1087591083 11:100188596-100188618 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1089588375 11:119524214-119524236 AGGTGAGGGAGCGGAGGAGAGGG + Intergenic
1092505439 12:9093817-9093839 TTGAGAGGCCGAGGCCGAGACGG + Intronic
1092750996 12:11719129-11719151 TAGTGAGGCCGCTGGGGAGAGGG + Intronic
1093575722 12:20727334-20727356 TGGTGAGGCTGCGGAGAAAAGGG - Intronic
1096871467 12:54595142-54595164 TGGTGAAGACGGGGAAGAGATGG + Intergenic
1098455495 12:70668195-70668217 TGGTGAGGAGGAGGAAGAGAAGG + Intronic
1099717626 12:86316224-86316246 TGGTGAGGCTGCAGAGGAAAGGG + Intronic
1100962251 12:99975453-99975475 TGGTGAGGCTGCAGAGGAAAGGG - Intronic
1103125248 12:118416521-118416543 TTGTGAGGACGCCGAGGAGAAGG - Exonic
1103566297 12:121817485-121817507 TGGTGGGGAGGAGGACGAGAAGG + Exonic
1103615414 12:122148681-122148703 TGGTGAGGCCACTTACAAGAGGG - Intergenic
1104841648 12:131828652-131828674 TGGTGAGCGCGCGGGCGGGACGG + Exonic
1104954400 12:132457402-132457424 TGGTGAGGCGTCGGGAGAGAGGG + Intergenic
1108046213 13:46387104-46387126 TGGCGGGGCCGGGGGCGAGATGG - Intronic
1108543333 13:51465512-51465534 TGGTGAGGCAGCAAACCAGATGG + Intergenic
1109796295 13:67317565-67317587 TGGTGAGGCCGTGGAGAAAAAGG - Intergenic
1113683020 13:112257415-112257437 TGGTGAGGCTGGGGGCAAGAGGG - Intergenic
1116231716 14:42226895-42226917 TGGTGAGGCTGCAGAGGAAAAGG - Intergenic
1117612225 14:57496236-57496258 TGGCGAGGCCCCAGAGGAGATGG + Intergenic
1122745761 14:103896441-103896463 TGGTGAGACCCCAGAGGAGACGG + Intergenic
1126553149 15:49954682-49954704 TGGTGAGGCTGCGGAGAAAAGGG + Intronic
1130223657 15:82043034-82043056 TGGTGGGGCCGGGAAGGAGAAGG + Exonic
1131818567 15:96247792-96247814 TGGTGAGGCTGTGGAGAAGAGGG - Intergenic
1132612618 16:824833-824855 TGGTGGTGCCGCGGATGGGACGG - Intergenic
1136367751 16:29816654-29816676 CGGTAAGGCCGAGGACGAGGGGG + Exonic
1138635040 16:58331480-58331502 TGGTGAGGCGGTGGAGGAGGGGG + Intronic
1139409990 16:66751464-66751486 TGGTGAGGCCGCGGGCGGTCGGG - Exonic
1141480403 16:84302552-84302574 GGGAGAGGCCTCGGAGGAGATGG - Intronic
1141581537 16:85002909-85002931 TGGAGAGGCGGCGGCCAAGAGGG + Intronic
1141948345 16:87325070-87325092 AGGTGAGGCGGAGGCCGAGAGGG - Intronic
1146283114 17:31558207-31558229 TGGTGAGGCCAGGAAAGAGAAGG + Intergenic
1150285185 17:63950191-63950213 GGGTGAGGCCTCTGAAGAGAAGG + Intronic
1150727644 17:67664440-67664462 TGGTGAGGCCGTGGAGAAAACGG - Intronic
1151751954 17:76044237-76044259 TGGTGAGGCTGGGGACAGGAAGG + Intronic
1151954475 17:77373570-77373592 TGCTGCGGCCGCGGACGTGCTGG + Intronic
1152079904 17:78180265-78180287 TGGGGAGGCCGCCCACGAGGCGG - Intronic
1159377497 18:67612500-67612522 TGGTGAGGCCGAGGAGCAAAGGG + Intergenic
1160956818 19:1697405-1697427 TGGTGGGGCCGTGGGTGAGATGG + Intergenic
1161473371 19:4472421-4472443 GGGTGAGGCCGCGCGGGAGATGG + Exonic
1162246599 19:9406784-9406806 AGGGGAGACCGCGGACGAAAAGG + Intergenic
1165107028 19:33476513-33476535 TGGTGAAGCCGCAGTCAAGAGGG - Intronic
1165548715 19:36564604-36564626 TGGTGAGGCTGCGGAGAAAAGGG + Intronic
1167112026 19:47468216-47468238 TGGTGAGGCTGAGGAGCAGAGGG - Intronic
1167404739 19:49298561-49298583 TGGTGAGGCTGCAGAGGAAAGGG + Intronic
1168125238 19:54279167-54279189 TGGTGAGGCACCGGGGGAGAGGG - Intronic
1168172020 19:54595558-54595580 TGGTGAGGCCCCGGGGGAGAGGG + Intronic
1168479717 19:56709374-56709396 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
929083746 2:38147608-38147630 TGGTGAGGCTGCAGAGGAAAGGG + Intergenic
930872771 2:56184692-56184714 GGGCGGGGCCGCGGACGAGCCGG - Exonic
932448094 2:71792897-71792919 TGCTGAGGACTCGGAAGAGAGGG - Intergenic
935611321 2:105028832-105028854 TGGTGAGGCCGCAGAGAAAAGGG + Intergenic
941655828 2:168143860-168143882 TGGTGAGGCCAAGGAGGTGATGG - Intronic
942541014 2:177015760-177015782 TGGTGAGGAAGCGGAGGGGAGGG - Intergenic
945540206 2:211076117-211076139 TGGTGAGGCTGCAGAGGAAAAGG + Intergenic
947320264 2:228909310-228909332 TGGTGAGGCTGCGGAGAAAAAGG - Intronic
1170479344 20:16749908-16749930 TGGTGATGGCCAGGACGAGATGG + Exonic
1178977634 21:37233141-37233163 AGCTGAGGCCGCGGGCCAGAGGG - Intronic
1179724354 21:43333543-43333565 TGGTGAGGAGGAGGACGAGGAGG - Intergenic
1183655031 22:39179655-39179677 TGGTGAGGGCGAGGAACAGAAGG + Intergenic
1184877409 22:47284283-47284305 TGGTGAGGCTGTGGACTGGATGG + Intergenic
1185286847 22:50004992-50005014 AGGTGAAGCCACGGAGGAGAAGG + Intronic
950467396 3:13163408-13163430 TGGTGAGGCTGGGGATGCGAAGG - Intergenic
955338971 3:58110176-58110198 TGGTGGGGCCTGGGAGGAGATGG + Intronic
958473336 3:94549377-94549399 TGGTGAGGTGGGGGAAGAGATGG - Intergenic
959667013 3:108933688-108933710 TGGTGAGGCTGCAGAGAAGAAGG + Intronic
962478398 3:135777936-135777958 TGGTGAGGCTGGGGATGTGAGGG + Intergenic
962868208 3:139465496-139465518 TGGTGAGGAGGCAGTCGAGATGG + Intronic
965332974 3:167400338-167400360 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
966492610 3:180544971-180544993 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
969021706 4:4143560-4143582 TGGGGACGCCGCGGAGGAGGAGG - Intergenic
969732161 4:8963855-8963877 TGGGGACGCCGCGGAGGAGGAGG + Intergenic
974119987 4:57626695-57626717 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
979122857 4:116926049-116926071 GGGTGAGGCCGAGGACCAGGGGG - Intergenic
979859327 4:125674699-125674721 TGGTTAGGTCGCTGAGGAGAGGG - Intergenic
980962696 4:139492128-139492150 GGGTGAGGCTGGGGAGGAGAGGG - Intergenic
981315577 4:143336899-143336921 TGCTGAGGCAGCTGGCGAGACGG + Exonic
984667994 4:182448821-182448843 GGGTGAGGCGGCGGCCGAGCCGG + Intronic
985966561 5:3342652-3342674 TGGTGTGGCCCAGGACAAGAGGG - Intergenic
986658560 5:10038761-10038783 TGGTGAGGCCGCAGGGGATAAGG - Intergenic
987848756 5:23322273-23322295 TGGTGAGGCTGCAGAGAAGAGGG + Intergenic
987996629 5:25290474-25290496 TGGTGAGGCTGCAGAGGAAAAGG + Intergenic
989478829 5:41904466-41904488 TGGTGAGGGAGCGGAGGAGAGGG + Exonic
990604998 5:57400329-57400351 TGGTGAGGACGCAGAGAAGAGGG - Intergenic
993322306 5:86487236-86487258 TGGTGAGGCCGTGGAGAAAAAGG + Intergenic
997174400 5:131759604-131759626 TGGTGAGGCCGTGGAGAAAAAGG + Intronic
999740558 5:154547025-154547047 TGGTGAGGCTGCGGAGAAAAGGG + Intergenic
1000220901 5:159212871-159212893 TGCTGAGGGCTGGGACGAGAAGG - Intergenic
1000618815 5:163460059-163460081 TGGTGCGGCCGCGGCCGGGAGGG - Exonic
1001333284 5:170777412-170777434 TGGGGAGGCTGCTGACGAGGTGG + Intronic
1001805906 5:174585977-174585999 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1003566753 6:7229161-7229183 TGGTGACGCCCTGGACCAGAAGG + Exonic
1003942745 6:11044575-11044597 AGGGGACGCCGCGGACGCGAGGG - Intergenic
1005915261 6:30345533-30345555 AGGTGAGGCCCGGGACGAGGAGG - Exonic
1009773329 6:68173698-68173720 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
1011238718 6:85247307-85247329 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1019208885 6:170388325-170388347 TGGTGAGGCCGCGGACGAGAAGG - Exonic
1019427090 7:982995-983017 TGGTGGGGCCGGGGAGGGGAGGG - Intergenic
1020644219 7:10794509-10794531 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1023355910 7:39366794-39366816 TGGGGAGGCAGGGGAGGAGATGG + Intronic
1023497207 7:40810400-40810422 TGGTGAGGCTGCAGAGAAGAAGG - Intronic
1024049194 7:45608081-45608103 TGGTGAGGCCGTGGAGAAAAGGG - Intronic
1027270148 7:76514477-76514499 AGGTGAGGCCCGGGAGGAGAAGG - Intronic
1027578045 7:79955840-79955862 TGGTGAGGCTGCAGACAAAAAGG + Intergenic
1028699942 7:93765779-93765801 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1030993278 7:116327298-116327320 TGGCGAGGCTGCGGAGGAAAGGG - Intronic
1032912622 7:136450974-136450996 TGGTGAGGCCGTGGAGAAAAGGG - Intergenic
1033573816 7:142660136-142660158 TGGTGAGGCTGCAGAAGAAAGGG - Intergenic
1033586387 7:142777821-142777843 TGGTGAGGCTGCAGAGGAAATGG - Intergenic
1035042585 7:155941025-155941047 TGGAGAGGCTGCAGATGAGACGG + Intergenic
1038399785 8:27274696-27274718 TGGTGACGCCCCAGAAGAGAGGG - Intergenic
1039092837 8:33850777-33850799 TGGTGAGGCTGTGGAGGAAAGGG - Intergenic
1042764337 8:72303733-72303755 TGGTGAGGCTGCAGACAAAAGGG - Intergenic
1044784976 8:95783825-95783847 TGGTGAGGTCGCTGCCAAGAGGG + Intergenic
1045698840 8:104842338-104842360 TGGTGAGGCTGCTGCAGAGAAGG - Intronic
1046024730 8:108708499-108708521 TGGTGAGGCTGCGGAGAAAAGGG - Intronic
1048609183 8:136003382-136003404 TGGTGAGTCCGTGGAGGAAAAGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1051621012 9:19049482-19049504 TGGAGAGGCCGCGGACGGGCTGG - Exonic
1052886416 9:33652542-33652564 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1052902139 9:33802477-33802499 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1053273651 9:36767039-36767061 TGGTGAGGCCCATGAGGAGAGGG - Intergenic
1058269309 9:102950074-102950096 TGGTGAGGCTGAGGAGGAAAGGG - Intergenic
1060477926 9:123999613-123999635 TGGGGAGGCCGGGGACGCGGGGG + Intergenic
1061475308 9:130861623-130861645 TGGTGATGCTTGGGACGAGAGGG - Intronic
1062571611 9:137188395-137188417 TGGTGAGGCCTGGGAAGAGAGGG - Exonic
1193942441 X:87692206-87692228 TGGTGAGGCTGCAGAGGAAAGGG + Intergenic
1194904108 X:99552169-99552191 TGGTGAGGCTGTGGAGGAAAGGG - Intergenic
1198127175 X:133656991-133657013 TGGTGGGGGAGTGGACGAGATGG - Intronic