ID: 1019211464

View in Genome Browser
Species Human (GRCh38)
Location 6:170408738-170408760
Sequence CTGGAGAGACGGCCTTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019211464_1019211467 -10 Left 1019211464 6:170408738-170408760 CCTACCTAAGGCCGTCTCTCCAG No data
Right 1019211467 6:170408751-170408773 GTCTCTCCAGCTGTGAACCCAGG No data
1019211464_1019211468 -9 Left 1019211464 6:170408738-170408760 CCTACCTAAGGCCGTCTCTCCAG No data
Right 1019211468 6:170408752-170408774 TCTCTCCAGCTGTGAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019211464 Original CRISPR CTGGAGAGACGGCCTTAGGT AGG (reversed) Intergenic
No off target data available for this crispr