ID: 1019215120

View in Genome Browser
Species Human (GRCh38)
Location 6:170438563-170438585
Sequence ACACGGGCACAGATGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019215120_1019215127 -10 Left 1019215120 6:170438563-170438585 CCACCCTCCATCTGTGCCCGTGT No data
Right 1019215127 6:170438576-170438598 GTGCCCGTGTCAGGGCTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019215120 Original CRISPR ACACGGGCACAGATGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr