ID: 1019215986

View in Genome Browser
Species Human (GRCh38)
Location 6:170444175-170444197
Sequence GCTCAGAGCAGAAGGCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019215983_1019215986 -5 Left 1019215983 6:170444157-170444179 CCTGGCAGCTAGGCCTGGGCTCA No data
Right 1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG No data
1019215976_1019215986 19 Left 1019215976 6:170444133-170444155 CCCCGAGTATGAGCTGATTTGAC No data
Right 1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG No data
1019215977_1019215986 18 Left 1019215977 6:170444134-170444156 CCCGAGTATGAGCTGATTTGACA No data
Right 1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG No data
1019215978_1019215986 17 Left 1019215978 6:170444135-170444157 CCGAGTATGAGCTGATTTGACAC No data
Right 1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019215986 Original CRISPR GCTCAGAGCAGAAGGCTTGT AGG Intergenic
No off target data available for this crispr