ID: 1019216516

View in Genome Browser
Species Human (GRCh38)
Location 6:170447360-170447382
Sequence GCTGCTGGTGCGGGCCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019216510_1019216516 16 Left 1019216510 6:170447321-170447343 CCAGCGTGCTTAGCAACTCTCTC No data
Right 1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019216516 Original CRISPR GCTGCTGGTGCGGGCCCTGC CGG Intergenic
No off target data available for this crispr