ID: 1019217307

View in Genome Browser
Species Human (GRCh38)
Location 6:170452203-170452225
Sequence CAACCAGCACTGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019217293_1019217307 30 Left 1019217293 6:170452150-170452172 CCCTGGTTCAAAGGCCAGAGCCA No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217301_1019217307 -3 Left 1019217301 6:170452183-170452205 CCCCTTGTGGGTTCCGTCACCAA No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217296_1019217307 16 Left 1019217296 6:170452164-170452186 CCAGAGCCAGAGATGCCGGCCCC No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217297_1019217307 10 Left 1019217297 6:170452170-170452192 CCAGAGATGCCGGCCCCTTGTGG No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217294_1019217307 29 Left 1019217294 6:170452151-170452173 CCTGGTTCAAAGGCCAGAGCCAG No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217302_1019217307 -4 Left 1019217302 6:170452184-170452206 CCCTTGTGGGTTCCGTCACCAAC No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217300_1019217307 1 Left 1019217300 6:170452179-170452201 CCGGCCCCTTGTGGGTTCCGTCA No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data
1019217303_1019217307 -5 Left 1019217303 6:170452185-170452207 CCTTGTGGGTTCCGTCACCAACC No data
Right 1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019217307 Original CRISPR CAACCAGCACTGATGGAACA TGG Intergenic
No off target data available for this crispr