ID: 1019217423

View in Genome Browser
Species Human (GRCh38)
Location 6:170452665-170452687
Sequence GCTCTTGGCCCCGGGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019217423_1019217430 -1 Left 1019217423 6:170452665-170452687 CCCAGTCCCCCGGGGCCAAGAGC No data
Right 1019217430 6:170452687-170452709 CAGACGCAGCCTGACAGAGTTGG No data
1019217423_1019217433 12 Left 1019217423 6:170452665-170452687 CCCAGTCCCCCGGGGCCAAGAGC No data
Right 1019217433 6:170452700-170452722 ACAGAGTTGGCGGCAGATTTAGG No data
1019217423_1019217431 2 Left 1019217423 6:170452665-170452687 CCCAGTCCCCCGGGGCCAAGAGC No data
Right 1019217431 6:170452690-170452712 ACGCAGCCTGACAGAGTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019217423 Original CRISPR GCTCTTGGCCCCGGGGGACT GGG (reversed) Intergenic