ID: 1019219083

View in Genome Browser
Species Human (GRCh38)
Location 6:170460813-170460835
Sequence GCCTCTGATGTGCAGGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219083_1019219091 17 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219091 6:170460853-170460875 TGAGGCACTAACTAAATGTTTGG No data
1019219083_1019219092 18 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219092 6:170460854-170460876 GAGGCACTAACTAAATGTTTGGG No data
1019219083_1019219093 28 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data
1019219083_1019219088 -1 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219088 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219083 Original CRISPR GCCTCTGATGTGCAGGCCCC CGG (reversed) Intergenic
No off target data available for this crispr