ID: 1019219087

View in Genome Browser
Species Human (GRCh38)
Location 6:170460835-170460857
Sequence CCTCAGGGCGCCTCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219087_1019219091 -5 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219091 6:170460853-170460875 TGAGGCACTAACTAAATGTTTGG No data
1019219087_1019219094 9 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data
1019219087_1019219093 6 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data
1019219087_1019219092 -4 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219092 6:170460854-170460876 GAGGCACTAACTAAATGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219087 Original CRISPR CCTCAGGGCGCCTCATCTCC AGG (reversed) Intergenic
No off target data available for this crispr