ID: 1019219088

View in Genome Browser
Species Human (GRCh38)
Location 6:170460835-170460857
Sequence CCTGGAGATGAGGCGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219085_1019219088 -8 Left 1019219085 6:170460820-170460842 CCTGCACATCAGAGGCCTGGAGA No data
Right 1019219088 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
1019219083_1019219088 -1 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219088 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
1019219080_1019219088 15 Left 1019219080 6:170460797-170460819 CCACAAAACACAGGGGCCGGGGG No data
Right 1019219088 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
1019219073_1019219088 29 Left 1019219073 6:170460783-170460805 CCTGAGTGCTCTGACCACAAAAC No data
Right 1019219088 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219088 Original CRISPR CCTGGAGATGAGGCGCCCTG AGG Intergenic
No off target data available for this crispr