ID: 1019219089

View in Genome Browser
Species Human (GRCh38)
Location 6:170460850-170460872
Sequence AACATTTAGTTAGTGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219089_1019219094 -6 Left 1019219089 6:170460850-170460872 CCCTGAGGCACTAACTAAATGTT No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data
1019219089_1019219093 -9 Left 1019219089 6:170460850-170460872 CCCTGAGGCACTAACTAAATGTT No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219089 Original CRISPR AACATTTAGTTAGTGCCTCA GGG (reversed) Intergenic
No off target data available for this crispr