ID: 1019219090

View in Genome Browser
Species Human (GRCh38)
Location 6:170460851-170460873
Sequence AAACATTTAGTTAGTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219090_1019219094 -7 Left 1019219090 6:170460851-170460873 CCTGAGGCACTAACTAAATGTTT No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data
1019219090_1019219093 -10 Left 1019219090 6:170460851-170460873 CCTGAGGCACTAACTAAATGTTT No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219090 Original CRISPR AAACATTTAGTTAGTGCCTC AGG (reversed) Intergenic
No off target data available for this crispr