ID: 1019219091

View in Genome Browser
Species Human (GRCh38)
Location 6:170460853-170460875
Sequence TGAGGCACTAACTAAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219087_1019219091 -5 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219091 6:170460853-170460875 TGAGGCACTAACTAAATGTTTGG No data
1019219083_1019219091 17 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219091 6:170460853-170460875 TGAGGCACTAACTAAATGTTTGG No data
1019219085_1019219091 10 Left 1019219085 6:170460820-170460842 CCTGCACATCAGAGGCCTGGAGA No data
Right 1019219091 6:170460853-170460875 TGAGGCACTAACTAAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219091 Original CRISPR TGAGGCACTAACTAAATGTT TGG Intergenic
No off target data available for this crispr