ID: 1019219093

View in Genome Browser
Species Human (GRCh38)
Location 6:170460864-170460886
Sequence CTAAATGTTTGGGTATGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219085_1019219093 21 Left 1019219085 6:170460820-170460842 CCTGCACATCAGAGGCCTGGAGA No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data
1019219083_1019219093 28 Left 1019219083 6:170460813-170460835 CCGGGGGCCTGCACATCAGAGGC No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data
1019219090_1019219093 -10 Left 1019219090 6:170460851-170460873 CCTGAGGCACTAACTAAATGTTT No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data
1019219089_1019219093 -9 Left 1019219089 6:170460850-170460872 CCCTGAGGCACTAACTAAATGTT No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data
1019219087_1019219093 6 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219093 6:170460864-170460886 CTAAATGTTTGGGTATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219093 Original CRISPR CTAAATGTTTGGGTATGCCT AGG Intergenic
No off target data available for this crispr