ID: 1019219094

View in Genome Browser
Species Human (GRCh38)
Location 6:170460867-170460889
Sequence AATGTTTGGGTATGCCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019219087_1019219094 9 Left 1019219087 6:170460835-170460857 CCTGGAGATGAGGCGCCCTGAGG No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data
1019219089_1019219094 -6 Left 1019219089 6:170460850-170460872 CCCTGAGGCACTAACTAAATGTT No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data
1019219085_1019219094 24 Left 1019219085 6:170460820-170460842 CCTGCACATCAGAGGCCTGGAGA No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data
1019219090_1019219094 -7 Left 1019219090 6:170460851-170460873 CCTGAGGCACTAACTAAATGTTT No data
Right 1019219094 6:170460867-170460889 AATGTTTGGGTATGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019219094 Original CRISPR AATGTTTGGGTATGCCTAGG AGG Intergenic
No off target data available for this crispr