ID: 1019224569

View in Genome Browser
Species Human (GRCh38)
Location 6:170499645-170499667
Sequence GCGTGGAGAGGGAGCGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019224564_1019224569 -7 Left 1019224564 6:170499629-170499651 CCCACACTCAGGGTTGGCGTGGA No data
Right 1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG No data
1019224558_1019224569 6 Left 1019224558 6:170499616-170499638 CCACTAAATCCAGCCCACACTCA No data
Right 1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG No data
1019224565_1019224569 -8 Left 1019224565 6:170499630-170499652 CCACACTCAGGGTTGGCGTGGAG No data
Right 1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG No data
1019224562_1019224569 -3 Left 1019224562 6:170499625-170499647 CCAGCCCACACTCAGGGTTGGCG No data
Right 1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019224569 Original CRISPR GCGTGGAGAGGGAGCGAGGA AGG Intergenic
No off target data available for this crispr