ID: 1019230487

View in Genome Browser
Species Human (GRCh38)
Location 6:170557078-170557100
Sequence CCTCAGGTAATATAGCAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019230479_1019230487 1 Left 1019230479 6:170557054-170557076 CCTTACGCTCAGGGCTTGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1019230478_1019230487 4 Left 1019230478 6:170557051-170557073 CCACCTTACGCTCAGGGCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1019230476_1019230487 8 Left 1019230476 6:170557047-170557069 CCTGCCACCTTACGCTCAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019230487 Original CRISPR CCTCAGGTAATATAGCAGGA GGG Exonic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
903003791 1:20285004-20285026 AGTCAGGTAATCTAACAGGATGG + Intergenic
904277563 1:29394416-29394438 CCACAGGTCACAGAGCAGGAGGG - Intergenic
905350304 1:37341177-37341199 CCTCAGGTAATAGTACAGGTGGG - Intergenic
906821410 1:48934237-48934259 GCTCAGCTATTATAGCAGGAGGG + Intronic
909358482 1:74734733-74734755 CCTCAGTTCATAGAACAGGAAGG - Intronic
911469171 1:98295360-98295382 CCTCTGATGATATAGCAGTAAGG - Intergenic
911493090 1:98593632-98593654 CATCAGGCAATCTGGCAGGAGGG + Intergenic
913318532 1:117573285-117573307 CCACAGGTAATGAAGCAGTAGGG - Intergenic
916964785 1:169926861-169926883 CATCAGGTAATATTGAAGGCTGG + Intronic
919721326 1:200839692-200839714 ACTCAGGGAAAAAAGCAGGAGGG + Intronic
921651159 1:217680221-217680243 CCTAAGGTCATATAGCTGGTTGG - Intronic
923591366 1:235322727-235322749 TATCAGGTAATATAGAATGAAGG - Intronic
923677884 1:236095960-236095982 ACTCAGGTAAGACAGCAGGCTGG - Intergenic
924105680 1:240646817-240646839 CCTAATGTAATATATCTGGAAGG - Intergenic
1062999809 10:1905946-1905968 CCTCAGGTCATATGACAGAAGGG - Intergenic
1063401219 10:5747903-5747925 CCTCAGTTACTTTACCAGGAAGG - Exonic
1065310784 10:24414460-24414482 CCTCAGGTAACAAAGCAGATGGG + Intronic
1066510814 10:36093781-36093803 CCTCTTGTAATTTAGCAGCAAGG - Intergenic
1068462183 10:57342676-57342698 CCTCCTGTAATATATCAGAAAGG - Intergenic
1070914907 10:80147194-80147216 CCACAGCTAATATTGCAGGTGGG - Intergenic
1074225226 10:111478287-111478309 CCTGAGGGAAAATGGCAGGAGGG - Intergenic
1074276998 10:112012704-112012726 CCTCAGGTCACAAAGCAGGAAGG + Intergenic
1081194490 11:40144645-40144667 CCTCAACAAATATAGGAGGAAGG + Intronic
1083736632 11:64685316-64685338 AATCAGGTGATTTAGCAGGAGGG - Intronic
1084620053 11:70263582-70263604 CCTCAGCGAATATCGCAGGGTGG + Intergenic
1088126317 11:106428502-106428524 CTTCTGGTAACATGGCAGGAAGG + Intergenic
1089160534 11:116433713-116433735 CTTCAGGTGAAATAGCAGCAAGG + Intergenic
1089528020 11:119109431-119109453 CCTCAAGGCAGATAGCAGGACGG - Intronic
1094074633 12:26459136-26459158 CCTCAGGAAATCTAGGAGGGTGG + Intronic
1098610890 12:72456586-72456608 CCACAGTTAATAGAGCATGAGGG - Intronic
1099553500 12:84078357-84078379 CCTGAGACAATATAGCAAGATGG + Intergenic
1099972948 12:89518481-89518503 CCTCAGGAAAAAAAGCAGGCTGG - Intronic
1101784965 12:107874761-107874783 CCCCAGGGACTAGAGCAGGAAGG + Intergenic
1104070846 12:125344177-125344199 TTTGAGGGAATATAGCAGGATGG + Intronic
1107258138 13:38455526-38455548 ACTCAGATAATATAACAGCATGG + Intergenic
1111138471 13:84083500-84083522 CCTCAGGAAATAAAGGAGGTTGG + Intergenic
1111378029 13:87406708-87406730 CCTCAGATAATATGGCAGGGGGG - Intergenic
1115170173 14:30495763-30495785 CATCAGGTAATATAGCTGATGGG - Intergenic
1115224799 14:31091281-31091303 CCTTAGTGAATATAACAGGAAGG + Intronic
1117640895 14:57798547-57798569 GCTCAGATAATATGACAGGATGG - Intronic
1121665399 14:95668182-95668204 CCTCTGGAAACTTAGCAGGAAGG - Intergenic
1125187389 15:36946877-36946899 CTAAAGGTAATATAGCATGATGG - Intronic
1125917156 15:43498345-43498367 TCTCAGTTAATATACCAGTAAGG + Intronic
1128941135 15:71788617-71788639 CTTCAGGGAAGAAAGCAGGAAGG + Intergenic
1129976776 15:79829360-79829382 CCACAGGAAAGATATCAGGAAGG + Intergenic
1130842219 15:87711447-87711469 GCTCAGGTAATAAGGAAGGAAGG + Intergenic
1134728005 16:16436289-16436311 ACTGAGTTAATATAGCAGCATGG - Intergenic
1134939431 16:18275537-18275559 ACTGAGTTAATATAGCAGCATGG + Intergenic
1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG + Intronic
1138330196 16:56207706-56207728 CTACAGGTAATAAAGCAGAATGG + Intronic
1138372269 16:56536555-56536577 CCTTAGTTAATGGAGCAGGAAGG + Intergenic
1144120331 17:12146445-12146467 CCTAAGGTAATACATCAAGAGGG + Intergenic
1146220971 17:31020056-31020078 CCTCATGTAATATAACATAATGG - Intergenic
1149491520 17:57088186-57088208 CCTGAGGTATTACACCAGGAAGG - Intronic
1150482877 17:65524128-65524150 CCCCAGGTGGTACAGCAGGAAGG + Intergenic
1151791051 17:76306300-76306322 CCTGGGGTGATATGGCAGGAGGG + Intronic
1157032917 18:43934780-43934802 CATCAGTTAATATATCAGCAGGG - Intergenic
1157044384 18:44081543-44081565 CCTTAAGTAATATTGCAGTAAGG - Intergenic
1157162780 18:45329531-45329553 CCTGAGGTAATTTATAAGGAGGG + Intronic
1158293691 18:55970460-55970482 CCTCAGGAAATGTAGAATGATGG - Intergenic
1159709997 18:71746386-71746408 CCTCAAGTAATAAAACAAGATGG - Intronic
1160305479 18:77730647-77730669 ACTAAGATAATATAGCAGCAAGG + Intergenic
925628623 2:5866796-5866818 CCTCAGAGTATATGGCAGGAGGG - Intergenic
927850365 2:26494894-26494916 CCTCTGTAAATATGGCAGGAGGG - Intronic
931778990 2:65563940-65563962 CATCAGGTCTTAGAGCAGGATGG - Intergenic
936445068 2:112588651-112588673 GCTCAGTAAATATAGCAGAATGG + Intronic
938776536 2:134545981-134546003 CAACAGGTAATATAGAAGGAGGG - Intronic
941750259 2:169128071-169128093 CCTCAGATAATACAGAAGGTAGG - Exonic
942947894 2:181689476-181689498 CCTCATTTGATATGGCAGGAGGG - Intergenic
945314021 2:208350999-208351021 CCTCAGAAAATGCAGCAGGAAGG + Intronic
945568723 2:211436674-211436696 CCTCAGCTAATATATCACAATGG + Intronic
945927275 2:215818682-215818704 TTTCATGAAATATAGCAGGAGGG - Intergenic
947691903 2:232146053-232146075 CTTCATGGAATATAGCAGCAAGG - Intronic
1170318900 20:15072670-15072692 CTCCAGATTATATAGCAGGATGG - Intronic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1171020545 20:21580848-21580870 CCTCAGTGAAGATGGCAGGATGG - Intergenic
1171315267 20:24185454-24185476 CCTCAGGTGATCCACCAGGAGGG + Intergenic
1173871831 20:46347017-46347039 ACTCAGGAAATGGAGCAGGAAGG - Intronic
1174192604 20:48750887-48750909 CCTGAGGTCACACAGCAGGAAGG - Intronic
1174403943 20:50291850-50291872 CCTGAGGCCATACAGCAGGAAGG + Intergenic
1175326841 20:58135489-58135511 CCTCAGGTAAGCCAGCAGGGAGG + Intergenic
1178783933 21:35634739-35634761 CCTCAGAGAAAATAGCATGATGG + Intronic
1180150081 21:45942951-45942973 CCCCAGGTGATTTATCAGGAAGG + Intergenic
950145238 3:10644995-10645017 TCTTAGGTAATATACCATGAAGG + Intronic
953549192 3:43887502-43887524 CCTCAGCAACCATAGCAGGAAGG - Intergenic
953973187 3:47362903-47362925 CGTGAGGTAATAGTGCAGGAAGG + Intergenic
961552684 3:127678095-127678117 CCTCAGCTTCTCTAGCAGGAGGG + Intronic
970863724 4:20735253-20735275 CATCCAGTAATATAGCTGGAGGG - Intronic
970968924 4:21959013-21959035 TCTCAGGTAAAATTGGAGGAGGG + Intergenic
971047751 4:22824536-22824558 CCTCAGGGAAGAGAGCAGGCAGG + Intergenic
972950720 4:44318965-44318987 CTTTAGGTAAGATGGCAGGAAGG + Intronic
975363321 4:73498118-73498140 ACTCAGGTAAGATAGCCGTAAGG - Intronic
977228982 4:94429010-94429032 CATCAGGTAATATGGCAAGTTGG + Intergenic
978030086 4:103930683-103930705 CCTCAGTTAATAGAGCTGCATGG - Intergenic
985616537 5:926420-926442 CATCAGGTGATAGAGAAGGAAGG - Intergenic
987059836 5:14232146-14232168 CCTAAGGTCATATAGCTGGTAGG + Intronic
987904518 5:24058827-24058849 GCTTAGGTAATACAGCAGTATGG - Intronic
988423164 5:31030796-31030818 TCTCAAGTAATACAGAAGGATGG + Intergenic
993127880 5:83857728-83857750 CATGAGGTAATATAGAACGAGGG - Intergenic
999453009 5:151692507-151692529 ACTCTGGAAATAGAGCAGGAAGG + Intergenic
999699016 5:154211154-154211176 CCTCAGGTATAAAGGCAGGAGGG + Intronic
1005502878 6:26445364-26445386 CCTGAGGGAATCTTGCAGGAAGG - Intronic
1005955909 6:30663286-30663308 GCTAAGGTAAAAAAGCAGGAAGG + Intronic
1008857887 6:56113288-56113310 CCTCAAGGATTATAGAAGGAAGG - Intronic
1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG + Exonic
1022477683 7:30722521-30722543 CCTCAGGTGAGATAACTGGAAGG + Intronic
1024209044 7:47188138-47188160 TCTCAGGGGATATTGCAGGAAGG - Intergenic
1027516423 7:79147740-79147762 CCCCAGGGAATGGAGCAGGAGGG + Intronic
1029939582 7:104465545-104465567 CCTCAGGAAACGTAGCAGAAAGG + Intronic
1031400573 7:121322102-121322124 CCTCAGGTAATATAGGAATTGGG + Intergenic
1032925254 7:136597262-136597284 CCTGAGGTGATAAAACAGGAAGG + Intergenic
1033600584 7:142885816-142885838 TCTCAGGTAATTTGGGAGGAGGG - Intergenic
1034548978 7:151808434-151808456 CCTCAGATAAAAGAGCAGCAGGG + Intronic
1034560854 7:151878144-151878166 CCTCAGAAACTAGAGCAGGAGGG - Intergenic
1039034621 8:33346275-33346297 CCTCAGATAATAGAAGAGGATGG - Intergenic
1041469663 8:58194534-58194556 GCTCAGCTAATATTGCAGAATGG + Intronic
1047322365 8:123799253-123799275 CCTGAGGTGATATGGCTGGAAGG + Intronic
1048228300 8:132612127-132612149 TCCCAGGTAATAAAGCAGGAAGG - Intronic
1048913272 8:139157173-139157195 TCTCAGGAAATAAAGCAGCATGG - Intergenic
1051212806 9:14763123-14763145 CTTCAAGTCATTTAGCAGGAGGG + Intronic
1053732720 9:41074226-41074248 CGGCAGGTACTTTAGCAGGACGG - Intergenic
1053871021 9:42492090-42492112 CCTCAGATAAGATGGCTGGAGGG - Intergenic
1054554670 9:66642776-66642798 CCTCAGATAAGATGGCTGGAGGG + Intergenic
1054695707 9:68357328-68357350 CGGCAGGTACTTTAGCAGGACGG + Exonic
1058669744 9:107350815-107350837 CTTCAGGTAATTCAACAGGAAGG - Intergenic
1058925166 9:109656156-109656178 CCTCATGTAACATAGGAGGAAGG + Intronic
1059334151 9:113558127-113558149 CCACAGGATGTATAGCAGGAGGG + Intronic
1060215969 9:121738347-121738369 TCTCAGTTAGTATTGCAGGAGGG + Intronic
1061200504 9:129135786-129135808 CCTCTGATAATATAGAAGGTTGG + Intronic
1188509631 X:30921249-30921271 ACTCAGGTAGGAAAGCAGGAAGG + Intronic
1189732843 X:44039746-44039768 CCTAAGGCAAAACAGCAGGAAGG - Intergenic
1190856123 X:54296692-54296714 CCTCAGGTTAAAAAGAAGGATGG - Intronic
1191706702 X:64101492-64101514 CCTGAGGTAATTGAGCAGAAGGG + Intergenic
1192945570 X:75963098-75963120 CCTTAGGCAATGTTGCAGGAAGG + Intergenic
1196088866 X:111717051-111717073 TCTCAGCTACTACAGCAGGAGGG - Intronic
1197299363 X:124759468-124759490 ACTCAGGAAAAAGAGCAGGAGGG - Intronic
1199525032 X:148782507-148782529 TCACAGTTAATATAGCAGGATGG + Intronic