ID: 1019241255

View in Genome Browser
Species Human (GRCh38)
Location 6:170663384-170663406
Sequence CTTTCCCCCATCGCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019241255_1019241259 20 Left 1019241255 6:170663384-170663406 CCCGAGGCTGCGATGGGGGAAAG No data
Right 1019241259 6:170663427-170663449 CTGAGGTGTTTCCCACAATATGG No data
1019241255_1019241257 3 Left 1019241255 6:170663384-170663406 CCCGAGGCTGCGATGGGGGAAAG No data
Right 1019241257 6:170663410-170663432 AATTCCAGCACATACTGCTGAGG No data
1019241255_1019241260 29 Left 1019241255 6:170663384-170663406 CCCGAGGCTGCGATGGGGGAAAG No data
Right 1019241260 6:170663436-170663458 TTCCCACAATATGGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019241255 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG (reversed) Intergenic
No off target data available for this crispr