ID: 1019242111

View in Genome Browser
Species Human (GRCh38)
Location 6:170675915-170675937
Sequence ATACAGAAAAGGAAAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019242111_1019242116 11 Left 1019242111 6:170675915-170675937 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1019242116 6:170675949-170675971 ATTAACTTAGTGGTTACCATGGG No data
1019242111_1019242114 1 Left 1019242111 6:170675915-170675937 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1019242114 6:170675939-170675961 TTCAAAAGATATTAACTTAGTGG No data
1019242111_1019242115 10 Left 1019242111 6:170675915-170675937 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1019242115 6:170675948-170675970 TATTAACTTAGTGGTTACCATGG No data
1019242111_1019242117 12 Left 1019242111 6:170675915-170675937 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1019242117 6:170675950-170675972 TTAACTTAGTGGTTACCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019242111 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr