ID: 1019243639

View in Genome Browser
Species Human (GRCh38)
Location 6:170691771-170691793
Sequence ATGGCTCCACACTGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019243639_1019243644 14 Left 1019243639 6:170691771-170691793 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1019243644 6:170691808-170691830 GCGCACCCAGCAGTCGGCTGTGG No data
1019243639_1019243642 8 Left 1019243639 6:170691771-170691793 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1019243642 6:170691802-170691824 TCTGCCGCGCACCCAGCAGTCGG No data
1019243639_1019243645 15 Left 1019243639 6:170691771-170691793 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1019243645 6:170691809-170691831 CGCACCCAGCAGTCGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019243639 Original CRISPR ATGGCTCCACACTGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr