ID: 1019247167

View in Genome Browser
Species Human (GRCh38)
Location 6:170716613-170716635
Sequence GGGTTAAAGTGCAAGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019247167_1019247170 -4 Left 1019247167 6:170716613-170716635 CCCCAAATCTTGCACTTTAACCC No data
Right 1019247170 6:170716632-170716654 ACCCCATAGAGAGCTCCTGAAGG No data
1019247167_1019247176 -1 Left 1019247167 6:170716613-170716635 CCCCAAATCTTGCACTTTAACCC No data
Right 1019247176 6:170716635-170716657 CCATAGAGAGCTCCTGAAGGGGG No data
1019247167_1019247172 -3 Left 1019247167 6:170716613-170716635 CCCCAAATCTTGCACTTTAACCC No data
Right 1019247172 6:170716633-170716655 CCCCATAGAGAGCTCCTGAAGGG No data
1019247167_1019247178 11 Left 1019247167 6:170716613-170716635 CCCCAAATCTTGCACTTTAACCC No data
Right 1019247178 6:170716647-170716669 CCTGAAGGGGGAATTTTAACTGG No data
1019247167_1019247174 -2 Left 1019247167 6:170716613-170716635 CCCCAAATCTTGCACTTTAACCC No data
Right 1019247174 6:170716634-170716656 CCCATAGAGAGCTCCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019247167 Original CRISPR GGGTTAAAGTGCAAGATTTG GGG (reversed) Intergenic
No off target data available for this crispr