ID: 1019248280

View in Genome Browser
Species Human (GRCh38)
Location 6:170724218-170724240
Sequence CAGTGCAGCCTCTGGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019248267_1019248280 22 Left 1019248267 6:170724173-170724195 CCAGGAAAGGGTCACCGGTGCAG No data
Right 1019248280 6:170724218-170724240 CAGTGCAGCCTCTGGGGTCCTGG No data
1019248273_1019248280 8 Left 1019248273 6:170724187-170724209 CCGGTGCAGGGGACTAAGGAGGC No data
Right 1019248280 6:170724218-170724240 CAGTGCAGCCTCTGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019248280 Original CRISPR CAGTGCAGCCTCTGGGGTCC TGG Intergenic
No off target data available for this crispr