ID: 1019252138

View in Genome Browser
Species Human (GRCh38)
Location 7:21542-21564
Sequence TATAGATAGCAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019252132_1019252138 28 Left 1019252132 7:21491-21513 CCCAAATAAAACTGGGTAAATAT No data
Right 1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG No data
1019252133_1019252138 27 Left 1019252133 7:21492-21514 CCAAATAAAACTGGGTAAATATC No data
Right 1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG No data
1019252134_1019252138 -7 Left 1019252134 7:21526-21548 CCAGCCAAAGAAAATATATAGAT No data
Right 1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019252138 Original CRISPR TATAGATAGCAGGCCAGGTG TGG Intergenic
No off target data available for this crispr