ID: 1019252933

View in Genome Browser
Species Human (GRCh38)
Location 7:29572-29594
Sequence ATTCAGTGGAAGGCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019252929_1019252933 27 Left 1019252929 7:29522-29544 CCTATTATTTATGTAAAAATGCA No data
Right 1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG No data
1019252928_1019252933 28 Left 1019252928 7:29521-29543 CCCTATTATTTATGTAAAAATGC No data
Right 1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG No data
1019252930_1019252933 -7 Left 1019252930 7:29556-29578 CCAGACTAAATTGTGTATTCAGT 0: 41
1: 63
2: 47
3: 40
4: 372
Right 1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019252933 Original CRISPR ATTCAGTGGAAGGCTGATGA AGG Intergenic
No off target data available for this crispr