ID: 1019254224

View in Genome Browser
Species Human (GRCh38)
Location 7:39143-39165
Sequence TTTCAAATGTGAATATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019254224_1019254229 15 Left 1019254224 7:39143-39165 CCTGGGTATATTCACATTTGAAA No data
Right 1019254229 7:39181-39203 TGGCTACTGCAGGCCTTTCCCGG 0: 5
1: 0
2: 1
3: 23
4: 247
1019254224_1019254227 -5 Left 1019254224 7:39143-39165 CCTGGGTATATTCACATTTGAAA No data
Right 1019254227 7:39161-39183 TGAAACTCAAATGTGGGCATTGG No data
1019254224_1019254230 23 Left 1019254224 7:39143-39165 CCTGGGTATATTCACATTTGAAA No data
Right 1019254230 7:39189-39211 GCAGGCCTTTCCCGGCTCAATGG No data
1019254224_1019254228 5 Left 1019254224 7:39143-39165 CCTGGGTATATTCACATTTGAAA No data
Right 1019254228 7:39171-39193 ATGTGGGCATTGGCTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019254224 Original CRISPR TTTCAAATGTGAATATACCC AGG (reversed) Intergenic
No off target data available for this crispr