ID: 1019255985

View in Genome Browser
Species Human (GRCh38)
Location 7:51449-51471
Sequence ATTGAGAACCCTAATAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019255984_1019255985 12 Left 1019255984 7:51414-51436 CCATATTGTGTCAATTAAAAAAA No data
Right 1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG No data
1019255981_1019255985 27 Left 1019255981 7:51399-51421 CCCCACGAATATGTGCCATATTG No data
Right 1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG No data
1019255983_1019255985 25 Left 1019255983 7:51401-51423 CCACGAATATGTGCCATATTGTG No data
Right 1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG No data
1019255982_1019255985 26 Left 1019255982 7:51400-51422 CCCACGAATATGTGCCATATTGT No data
Right 1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019255985 Original CRISPR ATTGAGAACCCTAATAAGTA TGG Intergenic
No off target data available for this crispr