ID: 1019256412

View in Genome Browser
Species Human (GRCh38)
Location 7:55241-55263
Sequence TAATGTGACTGGAGGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019256412_1019256425 29 Left 1019256412 7:55241-55263 CCACTTTCCCTCCAGTCACATTA No data
Right 1019256425 7:55293-55315 CTGCCTCCCTGCTTCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019256412 Original CRISPR TAATGTGACTGGAGGGAAAG TGG (reversed) Intergenic
No off target data available for this crispr