ID: 1019256878

View in Genome Browser
Species Human (GRCh38)
Location 7:58019-58041
Sequence CCGTTTTCCTGCCATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019256878_1019256882 -2 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256882 7:58040-58062 GGGTTCAGAGCCACAGGCTGAGG No data
1019256878_1019256883 3 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256883 7:58045-58067 CAGAGCCACAGGCTGAGGCCTGG No data
1019256878_1019256889 24 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256889 7:58066-58088 GGGGGACTTCACAGACAACTAGG No data
1019256878_1019256886 6 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256886 7:58048-58070 AGCCACAGGCTGAGGCCTGGGGG No data
1019256878_1019256884 4 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256884 7:58046-58068 AGAGCCACAGGCTGAGGCCTGGG No data
1019256878_1019256881 -8 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256881 7:58034-58056 GAAAACGGGTTCAGAGCCACAGG No data
1019256878_1019256885 5 Left 1019256878 7:58019-58041 CCAGCATCATGGCAGGAAAACGG No data
Right 1019256885 7:58047-58069 GAGCCACAGGCTGAGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019256878 Original CRISPR CCGTTTTCCTGCCATGATGC TGG (reversed) Intergenic
No off target data available for this crispr