ID: 1019258280

View in Genome Browser
Species Human (GRCh38)
Location 7:65345-65367
Sequence GCCCCACTGGACCACGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019258271_1019258280 7 Left 1019258271 7:65315-65337 CCGTGCATCTTGTGCAGAGGCCC No data
Right 1019258280 7:65345-65367 GCCCCACTGGACCACGGCTAAGG No data
1019258269_1019258280 9 Left 1019258269 7:65313-65335 CCCCGTGCATCTTGTGCAGAGGC No data
Right 1019258280 7:65345-65367 GCCCCACTGGACCACGGCTAAGG No data
1019258270_1019258280 8 Left 1019258270 7:65314-65336 CCCGTGCATCTTGTGCAGAGGCC No data
Right 1019258280 7:65345-65367 GCCCCACTGGACCACGGCTAAGG No data
1019258267_1019258280 28 Left 1019258267 7:65294-65316 CCAGGTGCTGTGGGGTCTGCCCC No data
Right 1019258280 7:65345-65367 GCCCCACTGGACCACGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019258280 Original CRISPR GCCCCACTGGACCACGGCTA AGG Intergenic
No off target data available for this crispr