ID: 1019259492

View in Genome Browser
Species Human (GRCh38)
Location 7:72899-72921
Sequence CACCCACACCTCCCCTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019259492_1019259501 6 Left 1019259492 7:72899-72921 CCGGCCCAGGGGAGGTGTGGGTG No data
Right 1019259501 7:72928-72950 CCAGGGATGGAGCCCTCACGTGG No data
1019259492_1019259504 28 Left 1019259492 7:72899-72921 CCGGCCCAGGGGAGGTGTGGGTG No data
Right 1019259504 7:72950-72972 GCCTCAAGAGATCAGCAGCCAGG No data
1019259492_1019259498 -7 Left 1019259492 7:72899-72921 CCGGCCCAGGGGAGGTGTGGGTG No data
Right 1019259498 7:72915-72937 GTGGGTGGCCAAGCCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019259492 Original CRISPR CACCCACACCTCCCCTGGGC CGG (reversed) Intergenic
No off target data available for this crispr