ID: 1019259501

View in Genome Browser
Species Human (GRCh38)
Location 7:72928-72950
Sequence CCAGGGATGGAGCCCTCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019259494_1019259501 2 Left 1019259494 7:72903-72925 CCCAGGGGAGGTGTGGGTGGCCA No data
Right 1019259501 7:72928-72950 CCAGGGATGGAGCCCTCACGTGG No data
1019259485_1019259501 21 Left 1019259485 7:72884-72906 CCAGATAAGAAGGTGCCGGCCCA No data
Right 1019259501 7:72928-72950 CCAGGGATGGAGCCCTCACGTGG No data
1019259492_1019259501 6 Left 1019259492 7:72899-72921 CCGGCCCAGGGGAGGTGTGGGTG No data
Right 1019259501 7:72928-72950 CCAGGGATGGAGCCCTCACGTGG No data
1019259495_1019259501 1 Left 1019259495 7:72904-72926 CCAGGGGAGGTGTGGGTGGCCAA No data
Right 1019259501 7:72928-72950 CCAGGGATGGAGCCCTCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019259501 Original CRISPR CCAGGGATGGAGCCCTCACG TGG Intergenic
No off target data available for this crispr