ID: 1019259504

View in Genome Browser
Species Human (GRCh38)
Location 7:72950-72972
Sequence GCCTCAAGAGATCAGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019259492_1019259504 28 Left 1019259492 7:72899-72921 CCGGCCCAGGGGAGGTGTGGGTG No data
Right 1019259504 7:72950-72972 GCCTCAAGAGATCAGCAGCCAGG No data
1019259494_1019259504 24 Left 1019259494 7:72903-72925 CCCAGGGGAGGTGTGGGTGGCCA No data
Right 1019259504 7:72950-72972 GCCTCAAGAGATCAGCAGCCAGG No data
1019259500_1019259504 -1 Left 1019259500 7:72928-72950 CCAGGGATGGAGCCCTCACGTGG No data
Right 1019259504 7:72950-72972 GCCTCAAGAGATCAGCAGCCAGG No data
1019259499_1019259504 4 Left 1019259499 7:72923-72945 CCAAGCCAGGGATGGAGCCCTCA No data
Right 1019259504 7:72950-72972 GCCTCAAGAGATCAGCAGCCAGG No data
1019259495_1019259504 23 Left 1019259495 7:72904-72926 CCAGGGGAGGTGTGGGTGGCCAA No data
Right 1019259504 7:72950-72972 GCCTCAAGAGATCAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019259504 Original CRISPR GCCTCAAGAGATCAGCAGCC AGG Intergenic
No off target data available for this crispr