ID: 1019260179

View in Genome Browser
Species Human (GRCh38)
Location 7:77692-77714
Sequence AGCCCCAACATGGAAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019260179_1019260187 15 Left 1019260179 7:77692-77714 CCTGAGCCTTCCATGTTGGGGCT No data
Right 1019260187 7:77730-77752 AGGACCACAGCCTCAGTGACTGG No data
1019260179_1019260185 -8 Left 1019260179 7:77692-77714 CCTGAGCCTTCCATGTTGGGGCT No data
Right 1019260185 7:77707-77729 TTGGGGCTTCTCGGAGACAGGGG No data
1019260179_1019260183 -10 Left 1019260179 7:77692-77714 CCTGAGCCTTCCATGTTGGGGCT No data
Right 1019260183 7:77705-77727 TGTTGGGGCTTCTCGGAGACAGG No data
1019260179_1019260186 -5 Left 1019260179 7:77692-77714 CCTGAGCCTTCCATGTTGGGGCT No data
Right 1019260186 7:77710-77732 GGGCTTCTCGGAGACAGGGGAGG No data
1019260179_1019260184 -9 Left 1019260179 7:77692-77714 CCTGAGCCTTCCATGTTGGGGCT No data
Right 1019260184 7:77706-77728 GTTGGGGCTTCTCGGAGACAGGG No data
1019260179_1019260189 22 Left 1019260179 7:77692-77714 CCTGAGCCTTCCATGTTGGGGCT No data
Right 1019260189 7:77737-77759 CAGCCTCAGTGACTGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019260179 Original CRISPR AGCCCCAACATGGAAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr