ID: 1019260756

View in Genome Browser
Species Human (GRCh38)
Location 7:80632-80654
Sequence CGTGAACAGGGGAGTCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019260756_1019260763 9 Left 1019260756 7:80632-80654 CCTCATGGACTCCCCTGTTCACG No data
Right 1019260763 7:80664-80686 AGCGCGCAAACCATCCCTGTCGG No data
1019260756_1019260767 30 Left 1019260756 7:80632-80654 CCTCATGGACTCCCCTGTTCACG No data
Right 1019260767 7:80685-80707 GGCTCCCAGTGAAATGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019260756 Original CRISPR CGTGAACAGGGGAGTCCATG AGG (reversed) Intergenic