ID: 1019261532

View in Genome Browser
Species Human (GRCh38)
Location 7:84546-84568
Sequence CTCTGGGTGAGGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019261532_1019261540 2 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261540 7:84571-84593 GCCAGGAGAGCGGGATGCCGAGG No data
1019261532_1019261546 30 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261546 7:84599-84621 GAACAGAGAAGGCCTCTTGCAGG No data
1019261532_1019261543 8 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261543 7:84577-84599 AGAGCGGGATGCCGAGGGACTGG No data
1019261532_1019261542 3 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261542 7:84572-84594 CCAGGAGAGCGGGATGCCGAGGG No data
1019261532_1019261538 -7 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261538 7:84562-84584 CCCAGAGAAGCCAGGAGAGCGGG No data
1019261532_1019261545 19 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261545 7:84588-84610 CCGAGGGACTGGAACAGAGAAGG No data
1019261532_1019261536 -8 Left 1019261532 7:84546-84568 CCTTCCTCACTCCTCACCCAGAG No data
Right 1019261536 7:84561-84583 ACCCAGAGAAGCCAGGAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019261532 Original CRISPR CTCTGGGTGAGGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr