ID: 1019263192

View in Genome Browser
Species Human (GRCh38)
Location 7:93879-93901
Sequence TGTTCCTCCAGGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019263192_1019263197 -5 Left 1019263192 7:93879-93901 CCTCCCACTTTCCTGGAGGAACA No data
Right 1019263197 7:93897-93919 GAACACCGCTGCTAGGCCCTAGG No data
1019263192_1019263201 25 Left 1019263192 7:93879-93901 CCTCCCACTTTCCTGGAGGAACA No data
Right 1019263201 7:93927-93949 CAGCTCAGCCACTTAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019263192 Original CRISPR TGTTCCTCCAGGAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr