ID: 1019265520 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:115357-115379 |
| Sequence | TGGACGCTCCCCCCCTCCAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019265513_1019265520 | 18 | Left | 1019265513 | 7:115316-115338 | CCAGTCGGAAACATGAGTAGAGT | No data | ||
| Right | 1019265520 | 7:115357-115379 | TGGACGCTCCCCCCCTCCACTGG | No data | ||||
| 1019265515_1019265520 | -5 | Left | 1019265515 | 7:115339-115361 | CCGCCAAGTTTCCCCTTCTGGAC | No data | ||
| Right | 1019265520 | 7:115357-115379 | TGGACGCTCCCCCCCTCCACTGG | No data | ||||
| 1019265516_1019265520 | -8 | Left | 1019265516 | 7:115342-115364 | CCAAGTTTCCCCTTCTGGACGCT | No data | ||
| Right | 1019265520 | 7:115357-115379 | TGGACGCTCCCCCCCTCCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019265520 | Original CRISPR | TGGACGCTCCCCCCCTCCAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||