ID: 1019265520

View in Genome Browser
Species Human (GRCh38)
Location 7:115357-115379
Sequence TGGACGCTCCCCCCCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019265513_1019265520 18 Left 1019265513 7:115316-115338 CCAGTCGGAAACATGAGTAGAGT No data
Right 1019265520 7:115357-115379 TGGACGCTCCCCCCCTCCACTGG No data
1019265515_1019265520 -5 Left 1019265515 7:115339-115361 CCGCCAAGTTTCCCCTTCTGGAC No data
Right 1019265520 7:115357-115379 TGGACGCTCCCCCCCTCCACTGG No data
1019265516_1019265520 -8 Left 1019265516 7:115342-115364 CCAAGTTTCCCCTTCTGGACGCT No data
Right 1019265520 7:115357-115379 TGGACGCTCCCCCCCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019265520 Original CRISPR TGGACGCTCCCCCCCTCCAC TGG Intergenic
No off target data available for this crispr