ID: 1019267665

View in Genome Browser
Species Human (GRCh38)
Location 7:127458-127480
Sequence CAACATCCACAGATTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019267665_1019267668 -3 Left 1019267665 7:127458-127480 CCCTGCTGAATCTGTGGATGTTG No data
Right 1019267668 7:127478-127500 TTGATCCTTTAGAAAGTGGCCGG No data
1019267665_1019267672 13 Left 1019267665 7:127458-127480 CCCTGCTGAATCTGTGGATGTTG No data
Right 1019267672 7:127494-127516 TGGCCGGTCCAAAGGGTAGTTGG No data
1019267665_1019267670 5 Left 1019267665 7:127458-127480 CCCTGCTGAATCTGTGGATGTTG No data
Right 1019267670 7:127486-127508 TTAGAAAGTGGCCGGTCCAAAGG No data
1019267665_1019267671 6 Left 1019267665 7:127458-127480 CCCTGCTGAATCTGTGGATGTTG No data
Right 1019267671 7:127487-127509 TAGAAAGTGGCCGGTCCAAAGGG No data
1019267665_1019267667 -7 Left 1019267665 7:127458-127480 CCCTGCTGAATCTGTGGATGTTG No data
Right 1019267667 7:127474-127496 GATGTTGATCCTTTAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019267665 Original CRISPR CAACATCCACAGATTCAGCA GGG (reversed) Intergenic
No off target data available for this crispr