ID: 1019268631

View in Genome Browser
Species Human (GRCh38)
Location 7:133713-133735
Sequence ACCTGGAGCCCTTTTTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019268626_1019268631 -3 Left 1019268626 7:133693-133715 CCCCCGAGGGAAGGATTCAGACC No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268624_1019268631 1 Left 1019268624 7:133689-133711 CCCGCCCCCGAGGGAAGGATTCA No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268625_1019268631 0 Left 1019268625 7:133690-133712 CCGCCCCCGAGGGAAGGATTCAG No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268627_1019268631 -4 Left 1019268627 7:133694-133716 CCCCGAGGGAAGGATTCAGACCT No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268622_1019268631 9 Left 1019268622 7:133681-133703 CCACACATCCCGCCCCCGAGGGA No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268618_1019268631 21 Left 1019268618 7:133669-133691 CCTCAGGTCCAGCCACACATCCC No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268628_1019268631 -5 Left 1019268628 7:133695-133717 CCCGAGGGAAGGATTCAGACCTG No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268629_1019268631 -6 Left 1019268629 7:133696-133718 CCGAGGGAAGGATTCAGACCTGG No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data
1019268619_1019268631 13 Left 1019268619 7:133677-133699 CCAGCCACACATCCCGCCCCCGA No data
Right 1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019268631 Original CRISPR ACCTGGAGCCCTTTTTCTTG AGG Intergenic
No off target data available for this crispr