ID: 1019268807

View in Genome Browser
Species Human (GRCh38)
Location 7:134416-134438
Sequence TGGGGTCAGCTGACGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019268807_1019268814 16 Left 1019268807 7:134416-134438 CCAGTCTCCGTCAGCTGACCCCA No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268807_1019268813 0 Left 1019268807 7:134416-134438 CCAGTCTCCGTCAGCTGACCCCA No data
Right 1019268813 7:134439-134461 CCGAGAGCACACACTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019268807 Original CRISPR TGGGGTCAGCTGACGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr