ID: 1019268813

View in Genome Browser
Species Human (GRCh38)
Location 7:134439-134461
Sequence CCGAGAGCACACACTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019268806_1019268813 1 Left 1019268806 7:134415-134437 CCCAGTCTCCGTCAGCTGACCCC No data
Right 1019268813 7:134439-134461 CCGAGAGCACACACTTACCCAGG No data
1019268805_1019268813 16 Left 1019268805 7:134400-134422 CCACTAAGCTTCTGTCCCAGTCT No data
Right 1019268813 7:134439-134461 CCGAGAGCACACACTTACCCAGG No data
1019268807_1019268813 0 Left 1019268807 7:134416-134438 CCAGTCTCCGTCAGCTGACCCCA No data
Right 1019268813 7:134439-134461 CCGAGAGCACACACTTACCCAGG No data
1019268808_1019268813 -7 Left 1019268808 7:134423-134445 CCGTCAGCTGACCCCACCGAGAG No data
Right 1019268813 7:134439-134461 CCGAGAGCACACACTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019268813 Original CRISPR CCGAGAGCACACACTTACCC AGG Intergenic
No off target data available for this crispr