ID: 1019268814

View in Genome Browser
Species Human (GRCh38)
Location 7:134455-134477
Sequence ACCCAGGAGAGAATCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019268810_1019268814 -3 Left 1019268810 7:134435-134457 CCCACCGAGAGCACACACTTACC No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268811_1019268814 -4 Left 1019268811 7:134436-134458 CCACCGAGAGCACACACTTACCC No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268807_1019268814 16 Left 1019268807 7:134416-134438 CCAGTCTCCGTCAGCTGACCCCA No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268808_1019268814 9 Left 1019268808 7:134423-134445 CCGTCAGCTGACCCCACCGAGAG No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268812_1019268814 -7 Left 1019268812 7:134439-134461 CCGAGAGCACACACTTACCCAGG No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268806_1019268814 17 Left 1019268806 7:134415-134437 CCCAGTCTCCGTCAGCTGACCCC No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data
1019268809_1019268814 -2 Left 1019268809 7:134434-134456 CCCCACCGAGAGCACACACTTAC No data
Right 1019268814 7:134455-134477 ACCCAGGAGAGAATCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019268814 Original CRISPR ACCCAGGAGAGAATCACACC CGG Intergenic
No off target data available for this crispr