ID: 1019270795

View in Genome Browser
Species Human (GRCh38)
Location 7:147236-147258
Sequence TCCATGGTTTGGAATTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019270795_1019270801 14 Left 1019270795 7:147236-147258 CCTTTTTAATTCCAAACCATGGA No data
Right 1019270801 7:147273-147295 AATGATGCCCTTCTAGAAGAGGG No data
1019270795_1019270802 18 Left 1019270795 7:147236-147258 CCTTTTTAATTCCAAACCATGGA No data
Right 1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG No data
1019270795_1019270805 26 Left 1019270795 7:147236-147258 CCTTTTTAATTCCAAACCATGGA No data
Right 1019270805 7:147285-147307 CTAGAAGAGGGAAGGCCTCTTGG No data
1019270795_1019270800 13 Left 1019270795 7:147236-147258 CCTTTTTAATTCCAAACCATGGA No data
Right 1019270800 7:147272-147294 AAATGATGCCCTTCTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019270795 Original CRISPR TCCATGGTTTGGAATTAAAA AGG (reversed) Intergenic
No off target data available for this crispr