ID: 1019270800

View in Genome Browser
Species Human (GRCh38)
Location 7:147272-147294
Sequence AAATGATGCCCTTCTAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019270798_1019270800 -3 Left 1019270798 7:147252-147274 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 1019270800 7:147272-147294 AAATGATGCCCTTCTAGAAGAGG No data
1019270795_1019270800 13 Left 1019270795 7:147236-147258 CCTTTTTAATTCCAAACCATGGA No data
Right 1019270800 7:147272-147294 AAATGATGCCCTTCTAGAAGAGG No data
1019270797_1019270800 2 Left 1019270797 7:147247-147269 CCAAACCATGGAAAAAGGACCTA 0: 14
1: 15
2: 18
3: 7
4: 111
Right 1019270800 7:147272-147294 AAATGATGCCCTTCTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019270800 Original CRISPR AAATGATGCCCTTCTAGAAG AGG Intergenic
No off target data available for this crispr