ID: 1019273663

View in Genome Browser
Species Human (GRCh38)
Location 7:164673-164695
Sequence GGATCTGAGAGGAGACTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019273663_1019273677 26 Left 1019273663 7:164673-164695 CCAGCGAGTCTCCTCTCAGATCC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1019273677 7:164722-164744 TCGTCTCTAAGATTAAATCCAGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019273663 Original CRISPR GGATCTGAGAGGAGACTCGC TGG (reversed) Intergenic
900104101 1:974866-974888 GAGTCAGGGAGGAGACTCGCTGG + Exonic
904393407 1:30200290-30200312 GGATCTCAGAGGAAACTCACAGG - Intergenic
907500881 1:54879216-54879238 GGCTGTGACAGGAGAATCGCTGG + Intronic
907784005 1:57594338-57594360 GGATTTGAGACGTGACACGCAGG + Intronic
907801699 1:57772535-57772557 GCATCTAGGAGTAGACTCGCTGG + Intronic
908166890 1:61467785-61467807 GGATCTGAGACCAGACACACTGG + Intergenic
908439393 1:64138509-64138531 GGAACTGAGAGGAGGCTGGGGGG + Intronic
910870035 1:91825046-91825068 GTGTCTGAGAGTAGAATCGCTGG - Intronic
912487572 1:110041242-110041264 GGAGCTGAGAGGTGACGCCCAGG - Intronic
916591858 1:166199029-166199051 GGATGTGAGGAGAGACTTGCTGG - Intergenic
917479059 1:175394908-175394930 GGATCAGAGAGGAGACGCTTGGG + Intronic
918076913 1:181177456-181177478 GGAGCTGGGAGGAGCCTAGCTGG + Intergenic
922718705 1:227889555-227889577 AGATCTGAGGGGAGAGTGGCTGG - Intergenic
924909179 1:248490619-248490641 GGAGCTGAGAGGAGACTCCGGGG + Intergenic
924914926 1:248557439-248557461 GGAGCTGAGAGGAGACTCCGGGG - Intergenic
1063145195 10:3289801-3289823 AGATCTGAGAGGAGAAGCGAGGG - Intergenic
1067014270 10:42744883-42744905 GGATCTGAGAGGCAACTTGAAGG - Intergenic
1067547488 10:47204760-47204782 GGATCAGAGAAGAGACTAGATGG - Intergenic
1068883280 10:62072668-62072690 GGATGTGAGAGGAGTCTAGATGG - Intronic
1069682576 10:70295819-70295841 AGATGTGAGAGGAAACTCTCTGG + Intergenic
1069799233 10:71071983-71072005 TGATCTGGGAGGAGAGTGGCTGG + Intergenic
1075129434 10:119725882-119725904 GGAGCTGGGAGGAGACACCCGGG + Intergenic
1075615098 10:123885030-123885052 GAATCTAAGATGAGACTGGCAGG - Intronic
1076176480 10:128372191-128372213 GGATCTGAGAGGGGCCACACAGG + Intergenic
1076782843 10:132733956-132733978 GGAGCTCCCAGGAGACTCGCAGG - Intronic
1077239728 11:1504199-1504221 AGAACGGAGAGGAGACTGGCAGG + Intergenic
1078120321 11:8501671-8501693 GGATCTAAGAGTAGAATTGCTGG - Intronic
1079592863 11:22201988-22202010 GGATCTGAAAGGAGACTAGTGGG + Intronic
1081504772 11:43704690-43704712 AGATATGAGAGGAGATTTGCTGG + Intronic
1089161448 11:116440653-116440675 GGATCAGAGAGAAGACTGGTAGG - Intergenic
1089359302 11:117875781-117875803 GGAGCTGGGAGCAGCCTCGCTGG - Intronic
1090652932 11:128823257-128823279 GGTTCTGAAAGGACACTAGCAGG + Intergenic
1091451073 12:572184-572206 GGCTCTGAGCGGAGAATCCCGGG + Intronic
1095488060 12:42704884-42704906 GGATCTGAGAGCAAACACACAGG - Intergenic
1097866177 12:64560871-64560893 GGATCTGATAGGAGACTCTCAGG + Intergenic
1104749042 12:131226981-131227003 GGATCTGAGTGGAGTCCCCCTGG + Intergenic
1104784080 12:131438583-131438605 GGATCTGAGTGGAGCCCCCCTGG - Intergenic
1108356770 13:49635348-49635370 GTATCTGAGGGGAGACTTCCTGG - Intergenic
1112212082 13:97387873-97387895 GCTTCAGAGAGGAGACTGGCAGG + Intronic
1116980403 14:51164024-51164046 GAATCTGAGAGGAGATTCACGGG + Intergenic
1118640221 14:67785274-67785296 GGCTCTGAGAGGAGGATGGCAGG + Exonic
1121187362 14:91986738-91986760 GCAACTGAGAGGAGACACACTGG - Intronic
1125794920 15:42397028-42397050 GGTTCTGAGAGGAGCCTTCCAGG + Intronic
1126341167 15:47642596-47642618 GAATCTGAGAGGAGACACAGGGG + Intronic
1127125622 15:55809017-55809039 GGAAAGGAGAGGAGACCCGCTGG + Intergenic
1128363662 15:66981750-66981772 GCATCTGGGAGGAGGCTGGCTGG + Intergenic
1131320506 15:91385404-91385426 GGCTCAGAGGGGAGACTGGCAGG + Intergenic
1131326186 15:91448459-91448481 GCATCTGAGAGGATACTGACAGG - Intergenic
1131362396 15:91805051-91805073 GGACCTGAGAGGAGAATCTGTGG + Intergenic
1131438948 15:92444255-92444277 GGATCTGAAGGCAGACTCCCAGG - Intronic
1132500337 16:282098-282120 GGATCTCACAGGTAACTCGCAGG + Exonic
1132630897 16:916862-916884 GGATCTGCGAGGGGACACCCGGG - Intronic
1134211384 16:12280216-12280238 GGAACTGAAAGGAGACTCACGGG + Intronic
1136505218 16:30698673-30698695 GGAAGGGAGAGGAGACACGCCGG - Intronic
1138229981 16:55329672-55329694 GCCTTTCAGAGGAGACTCGCTGG + Intronic
1138516778 16:57540482-57540504 GGGCCTGAGAGGAGACTGGCAGG + Intergenic
1139347087 16:66310897-66310919 GGCTTGGAGAGGAGAATCGCTGG + Intergenic
1139505671 16:67396950-67396972 GGCTCTGAGTGGGGACTCACTGG - Intronic
1140208168 16:72950315-72950337 GGAGTTGAGAGGAGAGTCGGCGG - Intronic
1141887377 16:86901826-86901848 TTATCTGAGCGGGGACTCGCTGG + Intergenic
1142520725 17:502901-502923 GGTTTTGAGAAGAGACCCGCTGG + Intergenic
1143703466 17:8679829-8679851 GGCTGAGACAGGAGACTCGCTGG - Intergenic
1144734874 17:17549687-17549709 GGAGCTGAGTGGAGACACACAGG - Intronic
1148147346 17:45374072-45374094 GGAACAGAGAGGAGACATGCTGG - Intergenic
1148204711 17:45772873-45772895 GGACCAGGGAGGAGACTCACTGG - Intergenic
1152684581 17:81687796-81687818 GGGTCTCATAGGAGACTCCCTGG + Intronic
1152855522 17:82663130-82663152 GGACCTGAGAGCAGACTGGGCGG + Intronic
1155633369 18:27921969-27921991 GGATGGGAGAGGACACCCGCAGG - Intergenic
1158981570 18:62767028-62767050 GGATCTGGCAGGAGAGTGGCTGG - Intronic
1160592517 18:79952099-79952121 GCATCGGAGCGGAGACCCGCGGG - Intergenic
1160869734 19:1271709-1271731 GGAGCTGAGATGAGACTGGCTGG + Intronic
1161266963 19:3368612-3368634 GGGGCAGAGAGGAGAATCGCAGG - Intronic
1161478451 19:4498855-4498877 GGATCTGAGAGGTCACCTGCAGG - Exonic
1164694339 19:30232244-30232266 GAAGCTGAGAGGAGACTCTCAGG - Intronic
1165357571 19:35313305-35313327 GGATCTGAGAGGAGGCTGCTGGG + Exonic
1166190965 19:41176254-41176276 GGCTCTGAGAGGAGAATGGGTGG + Intergenic
1168098501 19:54128689-54128711 GGATAACAGAGGAGACTGGCGGG - Intronic
924995786 2:359229-359251 GGAGCTGAGAGGAAGCTAGCAGG - Intergenic
925165491 2:1713384-1713406 GGATCTGACAGGAGGCACCCAGG + Intronic
925578469 2:5385049-5385071 GGGGCTGAGAGGGGACTGGCAGG - Intergenic
926555943 2:14357985-14358007 AAATCTTAGAGGAGACTCTCTGG + Intergenic
926777518 2:16437175-16437197 AGGTCTGGGAGGAGACTTGCAGG + Intergenic
927718648 2:25368865-25368887 GGACCTCAGAGGAGGCGCGCTGG + Intergenic
930235081 2:48881068-48881090 GGATCTGAGATGAGAATGGAGGG + Intergenic
933059274 2:77716318-77716340 GGAGGTGAGAGGAGACTCCCTGG + Intergenic
933441315 2:82318192-82318214 GTATTTGAGAGGAGACTTGAGGG + Intergenic
936251773 2:110873306-110873328 AGATCTGGGAGGAGGCTCGGTGG + Intronic
937352574 2:121175512-121175534 TGAGCTGAAAGGAGACTGGCAGG - Intergenic
946049452 2:216849852-216849874 GGAGCTCAGAGGACACTCCCAGG - Intergenic
948875374 2:240824144-240824166 GCATCTGAGAGGAGGCTCTCTGG + Intergenic
1170901221 20:20465407-20465429 GTGGCTGAGAGGAGACTCCCAGG + Intronic
1171203400 20:23259734-23259756 GGAGAGGAGAGGAGACTCTCTGG + Intergenic
1174114231 20:48215819-48215841 GGAGCTCAGAGGAGACTCCTGGG - Intergenic
1174207398 20:48850685-48850707 GGATCTGAGAGGAGGGGAGCTGG + Intergenic
1175492717 20:59389973-59389995 AGATCCCAGAGGAGAGTCGCTGG + Intergenic
1175502831 20:59462359-59462381 GGGTCTGGGAGGAGCCTCTCAGG + Intergenic
1177773449 21:25542988-25543010 GCATCAGAGAGGAGACCTGCTGG + Intergenic
1179371025 21:40806092-40806114 GGATCTGAGAAGAGCCCAGCAGG - Intronic
1180178866 21:46108952-46108974 GGAGCTCACAGGAGACCCGCAGG + Intronic
1182395620 22:30033857-30033879 GGAGCTGAGAGGTCACTCCCTGG + Intergenic
1182674936 22:32031689-32031711 GGAACTGAGAGGAGACTCCGGGG + Intergenic
1184987765 22:48146960-48146982 AAATCTGAGAGGAGACCTGCTGG - Intergenic
950462931 3:13135914-13135936 GGACATGAGAGGAGAAGCGCAGG + Intergenic
951416767 3:22433435-22433457 GGATCTGAGTGGATCCTCTCAGG - Intergenic
952220498 3:31319455-31319477 GGATCTGAAAGCAGTCTCCCAGG + Intergenic
956492163 3:69784659-69784681 GGATTAGAGTGGAGACTAGCTGG - Intronic
963598803 3:147359649-147359671 AAATTTGAGGGGAGACTCGCTGG + Intergenic
966024393 3:175258368-175258390 GGATCTGAAATGAGACTGCCTGG - Intronic
967107933 3:186268991-186269013 GGATCTGGGAGGGGACGCGGGGG + Intronic
967446574 3:189574012-189574034 GGATCTGTGAGGAGACTGACAGG + Intergenic
973316570 4:48766612-48766634 GGAACCGAGAGCAGACTCACAGG + Intronic
976475185 4:85475287-85475309 GGACCAGAGAGGAGCCTGGCGGG + Exonic
978425848 4:108581485-108581507 GGGTCTCAGAGGAGTCTCTCAGG - Intergenic
981123955 4:141084548-141084570 GCATTTGAGAGCAGACTTGCTGG - Intronic
982061855 4:151612754-151612776 GGATCTAAGAAGAGGCTCTCAGG + Intronic
983772471 4:171569213-171569235 GGCTATGAAAGGAGACTCACCGG + Intergenic
984128100 4:175837297-175837319 AGGTCTGAAAGGAGTCTCGCTGG - Intronic
986370232 5:7072952-7072974 TGATCTGAGAGGAAAAACGCTGG - Intergenic
987182700 5:15384678-15384700 AGATGAGGGAGGAGACTCGCGGG + Intergenic
990309053 5:54520250-54520272 GGATCTGAGAGCAGCGTTGCTGG + Intronic
990491174 5:56304295-56304317 GGCTCTGAGAGGAGAGTGGCTGG + Intergenic
996790186 5:127284214-127284236 GCATCTGGGAGGAGACTCATGGG + Intergenic
997673554 5:135695733-135695755 GCATCAGAGGGGAGACTCCCAGG - Intergenic
1002444257 5:179279568-179279590 GGCTCTGAGAGGAGGCGCCCTGG - Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005470236 6:26156224-26156246 GGATCCGAGAGGACACTCTGCGG + Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1006278092 6:33022155-33022177 GGATCAGGGAGGAGAGGCGCGGG + Intergenic
1007836380 6:44677122-44677144 GGATTTAACAGGAGACTCACAGG - Intergenic
1012396247 6:98800847-98800869 GGATCCTAGAGGAGACTGTCAGG - Intergenic
1012988407 6:105899417-105899439 GGCTGAGGGAGGAGACTCGCTGG - Intergenic
1016983906 6:149879919-149879941 GGAGAAGAGAGGAGAGTCGCGGG + Intergenic
1017519601 6:155190220-155190242 GGATCAGAGAGGTGACAGGCAGG - Intronic
1018859935 6:167704122-167704144 GGAGCTGGGAGGAGTCTCTCCGG - Intergenic
1018859940 6:167704143-167704165 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859945 6:167704164-167704186 GGAGCTGGGAGGAGTCTCTCCGG - Intergenic
1018859954 6:167704206-167704228 GGAGCTGGGAGGAGTCTCTCCGG - Intergenic
1018859959 6:167704227-167704249 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859964 6:167704248-167704270 GGAGCTGGGAGGAGTCTCTCCGG - Intergenic
1018859989 6:167704374-167704396 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859994 6:167704395-167704417 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859999 6:167704416-167704438 GGAGCTGGGAGGAGTCTCTCCGG - Intergenic
1018860004 6:167704437-167704459 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018860016 6:167704500-167704522 GGAGCTGGGAGGAGTCTCTCTGG - Intergenic
1018860021 6:167704521-167704543 GGAGCTGGGAGGAGTCTCTCCGG - Intergenic
1018860025 6:167704542-167704564 GGAGCTGGGAGGAGTCTCTCTGG - Intergenic
1018860034 6:167704584-167704606 GGAGCTGGGAGGAGTCTCTCTGG - Intergenic
1018996392 6:168713656-168713678 GTATCTGACAGGAGACCCCCGGG - Intergenic
1019154900 6:170032265-170032287 GGCTCAGGGAGGAGACTCGGAGG + Intergenic
1019273663 7:164673-164695 GGATCTGAGAGGAGACTCGCTGG - Intergenic
1020432152 7:8125447-8125469 AGATCTGAGCAGAGACTTGCAGG - Intronic
1024898686 7:54292386-54292408 GGATCTGTGAGAAGACTCCAGGG - Intergenic
1028985135 7:97003512-97003534 GGAACTCGGAGGAAACTCGCGGG + Intergenic
1029375024 7:100171993-100172015 GGATCTGGGAAGAGACTCTGGGG - Intronic
1029457359 7:100677974-100677996 GGCTCTGAGAAGAGCCTCCCTGG + Intronic
1032075708 7:128835164-128835186 GCATCTGAGTGGGGCCTCGCAGG + Intronic
1034299047 7:149999100-149999122 GGATCTGGGAGCAGACTGGCTGG - Intergenic
1034378270 7:150665623-150665645 GGCTCTGAGAGCAGACAGGCAGG + Intergenic
1034806970 7:154097673-154097695 GGATCTGGGAGCAGACTGGCTGG + Intronic
1034872645 7:154697347-154697369 TGGCCTGAGAGGAGCCTCGCAGG - Intronic
1035367595 7:158359138-158359160 GGGTCTGAGCAGGGACTCGCCGG - Intronic
1036615297 8:10382972-10382994 GGATGTGAGAGGACAATCCCTGG + Intronic
1037668721 8:20996420-20996442 GGATCTGGGAGGAGAACTGCTGG - Intergenic
1037989405 8:23309738-23309760 GGATCTGGGAGGAGAAGCGCAGG + Exonic
1039446359 8:37636348-37636370 GTAAGTGAGAGGAGACTCGAAGG - Intergenic
1048768475 8:137869284-137869306 TGATCTGAGAGAGGACTCCCTGG + Intergenic
1048986876 8:139739472-139739494 GGCTCTGGGAGGAAACTCGTAGG - Intronic
1049624158 8:143612662-143612684 GGATCAGAGTGGACACGCGCAGG + Exonic
1052863731 9:33452729-33452751 GGATGTGAGAGGACTCTGGCTGG + Intergenic
1057551739 9:96056133-96056155 GGACCTGAGATGAGCCTCTCTGG + Intergenic
1061559466 9:131393787-131393809 GGATCGGGGAGGAGACCCGGAGG - Intergenic
1061631463 9:131874684-131874706 GTAGCTGCGAGGAGACGCGCTGG + Intronic
1062100918 9:134728200-134728222 GGAGCTGGGAGGAGCCTGGCAGG - Intronic
1062298784 9:135851884-135851906 TACTCTGAGAGGGGACTCGCTGG + Intronic
1062318342 9:135978770-135978792 GGGTCTGAGAGGAGAGCCCCTGG - Intergenic
1062368458 9:136223684-136223706 GGATCTGTGATGAGATTTGCAGG - Intronic
1186761107 X:12722877-12722899 TGATCTGAGATGAGACTCACAGG - Exonic
1190328152 X:49219276-49219298 GGAGCTGAGGGGACACTCCCAGG - Intronic
1190597227 X:52061979-52062001 GAATCTGAGAGGAGGCGCTCTGG + Exonic
1190611597 X:52192094-52192116 GAATCTGAGAGGAGGCGCTCTGG - Exonic
1196330362 X:114465847-114465869 GAAACTGAGAGGGGACTTGCAGG + Intergenic
1199315878 X:146377392-146377414 GGATCAGAGAGGAGGCTGGTTGG + Intergenic
1199693456 X:150326998-150327020 GGATTTCAGAGCACACTCGCTGG - Intergenic
1200846568 Y:7836816-7836838 GGATCTGAGAGTAGTGTAGCAGG - Intergenic