ID: 1019275449

View in Genome Browser
Species Human (GRCh38)
Location 7:173269-173291
Sequence CTGTGTCCACAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019275438_1019275449 25 Left 1019275438 7:173221-173243 CCAGTGCCGAAGCTTGGGTTCTC No data
Right 1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG No data
1019275440_1019275449 19 Left 1019275440 7:173227-173249 CCGAAGCTTGGGTTCTCTGAGGA No data
Right 1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019275449 Original CRISPR CTGTGTCCACAGATGGGGCA GGG Intergenic
No off target data available for this crispr