ID: 1019275539

View in Genome Browser
Species Human (GRCh38)
Location 7:173641-173663
Sequence TCCAGGGGCCATGGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019275526_1019275539 8 Left 1019275526 7:173610-173632 CCAGGACCCATCGCTGAGGAGCA No data
Right 1019275539 7:173641-173663 TCCAGGGGCCATGGGGCCCGGGG No data
1019275529_1019275539 2 Left 1019275529 7:173616-173638 CCCATCGCTGAGGAGCAGGAGGT No data
Right 1019275539 7:173641-173663 TCCAGGGGCCATGGGGCCCGGGG No data
1019275530_1019275539 1 Left 1019275530 7:173617-173639 CCATCGCTGAGGAGCAGGAGGTT No data
Right 1019275539 7:173641-173663 TCCAGGGGCCATGGGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019275539 Original CRISPR TCCAGGGGCCATGGGGCCCG GGG Intergenic
No off target data available for this crispr