ID: 1019280341

View in Genome Browser
Species Human (GRCh38)
Location 7:196618-196640
Sequence ACACACATGAAGCTAATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019280341_1019280346 19 Left 1019280341 7:196618-196640 CCAGGCATTAGCTTCATGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1019280346 7:196660-196682 CTGAAAGGGTCCCAGCAGCCTGG No data
1019280341_1019280342 -6 Left 1019280341 7:196618-196640 CCAGGCATTAGCTTCATGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1019280342 7:196635-196657 GTGTGTCTCAGAAGCAACCTTGG 0: 1
1: 0
2: 0
3: 15
4: 150
1019280341_1019280348 21 Left 1019280341 7:196618-196640 CCAGGCATTAGCTTCATGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1019280348 7:196662-196684 GAAAGGGTCCCAGCAGCCTGGGG No data
1019280341_1019280343 4 Left 1019280341 7:196618-196640 CCAGGCATTAGCTTCATGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1019280343 7:196645-196667 GAAGCAACCTTGGTGCTGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
1019280341_1019280344 5 Left 1019280341 7:196618-196640 CCAGGCATTAGCTTCATGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1019280344 7:196646-196668 AAGCAACCTTGGTGCTGAAAGGG 0: 1
1: 0
2: 0
3: 16
4: 241
1019280341_1019280347 20 Left 1019280341 7:196618-196640 CCAGGCATTAGCTTCATGTGTGT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1019280347 7:196661-196683 TGAAAGGGTCCCAGCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019280341 Original CRISPR ACACACATGAAGCTAATGCC TGG (reversed) Intronic
900886451 1:5418796-5418818 ACACACATGCAGGTAAAGCACGG - Intergenic
901612814 1:10512507-10512529 ACACCCCTGAAGTTAATGCTGGG - Intronic
904239970 1:29137699-29137721 ACTATCATGAAGCAAATGCCTGG + Intergenic
905171626 1:36113231-36113253 ACACACAGGAGGCAAAGGCCTGG - Intronic
906857341 1:49322276-49322298 ACACACATTAAAAAAATGCCAGG + Intronic
909291973 1:73894598-73894620 ACATACATGAAAATAATGCAGGG + Intergenic
909466800 1:75982071-75982093 ACACACAGGCAGCTAAGACCTGG - Intergenic
915205942 1:154270422-154270444 ACAGACATGAAGCTGAGGCATGG - Exonic
919214027 1:194527944-194527966 ATACACATGATGCAAATTCCTGG - Intergenic
922505808 1:226124841-226124863 ACACACACCAAGCTAATCACAGG - Intergenic
922717108 1:227883459-227883481 CCACACCTGAAGCCAAGGCCTGG - Intergenic
923859017 1:237874316-237874338 ACACACATGAAGCTTGTTTCTGG + Intergenic
1067733679 10:48832653-48832675 TCAGCCATGAAGCTGATGCCCGG + Exonic
1067906168 10:50293852-50293874 ACACTCATGAAGGTCAAGCCTGG + Intergenic
1073911311 10:108348343-108348365 ACATACATAAATCTAATGGCAGG + Intergenic
1074563512 10:114555344-114555366 ACACACCGGAAACTAAGGCCTGG + Intronic
1075429970 10:122372225-122372247 ACACACAACAAGATAATCCCAGG - Intergenic
1075723619 10:124600779-124600801 GCTCACAGGAAGCCAATGCCAGG + Intronic
1075849344 10:125574494-125574516 AAACACATGAGGCCCATGCCCGG - Intergenic
1076289699 10:129335530-129335552 AAACACATGAAGCCAATGAAAGG + Intergenic
1078289913 11:9998723-9998745 ATACACATGATGACAATGCCTGG + Intronic
1080085335 11:28273955-28273977 ACATAAACTAAGCTAATGCCTGG + Intronic
1081516428 11:43835163-43835185 ACAAACATGAAACTAAACCCTGG - Intronic
1082731877 11:56807955-56807977 ACACACAAAAAAATAATGCCCGG - Intergenic
1084779642 11:71399865-71399887 CCACACCTGCAGCTGATGCCTGG - Intergenic
1086137727 11:83459171-83459193 ACAATCATAAAGCTAATCCCAGG + Exonic
1087595547 11:100249844-100249866 ATATACAAGAAGCTTATGCCAGG + Intronic
1089306065 11:117527000-117527022 ACACACATGACTATAGTGCCAGG + Intronic
1089813119 11:121147866-121147888 GCACACAGGGGGCTAATGCCAGG + Intronic
1094468551 12:30780283-30780305 GCAGACATGCAGCTAAGGCCAGG - Intergenic
1102788831 12:115626565-115626587 AAACATATGAAACTAATTCCAGG - Intergenic
1105469392 13:20678992-20679014 GCACATCTGACGCTAATGCCAGG - Intronic
1106234208 13:27848114-27848136 ACACCCATGAAGCTGATGCCTGG - Intergenic
1111065204 13:83081938-83081960 ACATAGAGGAAGTTAATGCCTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1118582047 14:67311014-67311036 AAACACTTAAAGCTAAGGCCAGG + Intronic
1122653233 14:103238720-103238742 GCACACCTGACGTTAATGCCAGG + Intergenic
1125242638 15:37593735-37593757 ACACACACGAAAATAAAGCCAGG - Intergenic
1125265572 15:37876451-37876473 ACACACATGGTGGTCATGCCAGG - Intergenic
1125925475 15:43559478-43559500 ATACACATGAAGCTCAGCCCAGG + Intronic
1125938617 15:43659029-43659051 ATACACATGAAGCTCAGCCCAGG + Intronic
1126360567 15:47841626-47841648 ACACACAAGAAATGAATGCCAGG + Intergenic
1127645619 15:60955506-60955528 AAAGACATGAAGTCAATGCCAGG - Intronic
1127813468 15:62585005-62585027 ACACACATGCAGTTGATGTCAGG + Intronic
1129129544 15:73481142-73481164 ACACACATGAAGCTGTTACTAGG - Intronic
1129677064 15:77637346-77637368 ACAAGCATGAAGTAAATGCCAGG - Intronic
1135993065 16:27229146-27229168 GCACTCAAGAAGCTAAGGCCAGG - Intronic
1137691726 16:50432839-50432861 CCACACAAGCAGCTCATGCCCGG - Intergenic
1138168501 16:54826092-54826114 ACACTCATTAAGCTTATGCCTGG + Intergenic
1139663651 16:68439980-68440002 ACACACATGAGGCTCTTTCCTGG - Intronic
1146101390 17:29986118-29986140 ACACACCTGACCTTAATGCCAGG - Intronic
1146639821 17:34531858-34531880 ACACACATAAATCTGATGTCAGG + Intergenic
1155245574 18:23905603-23905625 ACACAAAAGAAGCTAAAGCAAGG + Exonic
1156273356 18:35557705-35557727 ACACACATGAATATATTGGCCGG - Intergenic
1157229393 18:45900052-45900074 ACACACACGCAACAAATGCCTGG + Intronic
1157982431 18:52396818-52396840 AAACACATTAAACAAATGCCTGG + Intronic
1165865678 19:38935898-38935920 GCACACGTGAACTTAATGCCAGG - Intronic
1167513233 19:49908030-49908052 ACACCCATGAGGCTGCTGCCTGG + Intronic
1167863141 19:52301324-52301346 GCACATCTGATGCTAATGCCAGG - Intronic
926400019 2:12487644-12487666 CCACACATGGGGCGAATGCCTGG - Intergenic
931554645 2:63489026-63489048 ACTCACATGAAGCAACAGCCTGG + Intronic
934933540 2:98447481-98447503 ACCATCATGAAGCTAATCCCAGG + Intronic
936584963 2:113748496-113748518 ACACACATGAAAAGAATGGCAGG + Intronic
937244800 2:120485732-120485754 ACACACATGGACCCAATGCATGG - Intergenic
939104053 2:137928552-137928574 GCACACAAAAATCTAATGCCAGG + Intergenic
939405203 2:141746585-141746607 AGACACATGAAGTTAAAACCAGG + Intronic
940032835 2:149283205-149283227 TCACACAGCAAGGTAATGCCAGG - Intergenic
940781602 2:157939436-157939458 ACACACATGAAGTTAATGTTGGG - Intronic
946999390 2:225436453-225436475 ACACACATGGGGAAAATGCCAGG - Intronic
948382074 2:237557779-237557801 ACCCACAGGAAACTAATGCAGGG - Intergenic
1173069018 20:39743503-39743525 ACCCACATAATGATAATGCCAGG + Intergenic
1176020402 20:62959720-62959742 ACACACAGGAAGCGCCTGCCTGG - Intronic
1178851764 21:36218234-36218256 ATACACAGGAAGCCAAGGCCAGG + Intronic
1179388996 21:40970245-40970267 AAACACATCAAGCAGATGCCTGG - Intergenic
1181815368 22:25432488-25432510 CCACTCAGGAAGCTAAGGCCAGG - Intergenic
1184105141 22:42363038-42363060 ACACTCATGCGGCTAATGCTTGG + Intergenic
1184310389 22:43637496-43637518 ACACGCAGGAAGCCAAGGCCAGG - Intronic
950685784 3:14617851-14617873 ACACACATGAAGCTGATGAAAGG + Intergenic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
957850967 3:85806996-85807018 ACAGACATTCAGCTAATGTCTGG + Intronic
958766546 3:98375451-98375473 ACATACATGACACTAATTCCAGG + Intergenic
959109086 3:102100232-102100254 AAATAAATGAAGCTAATGCATGG - Intronic
961157455 3:124692152-124692174 AAACACGAGAGGCTAATGCCTGG - Intronic
963995769 3:151706570-151706592 GCACACATGACCTTAATGCCAGG + Intergenic
964414437 3:156432660-156432682 AGAAAAATGAAGCTAATTCCAGG - Intronic
966967840 3:185013509-185013531 ACACACCTGACCTTAATGCCAGG - Intronic
967312665 3:188120884-188120906 ACACACATGAAAATAATTCAGGG + Intergenic
967792003 3:193559939-193559961 ACTGACATGAAGCTTCTGCCTGG - Intronic
968518746 4:1026132-1026154 ACACACGTGCAGATATTGCCTGG + Exonic
971278474 4:25220668-25220690 AGGCACATGAAGCTAAGTCCAGG - Intronic
973008982 4:45048257-45048279 GCACACCTGAACTTAATGCCAGG + Intergenic
975713179 4:77180642-77180664 AAACACATGAAGCTACTGAAGGG + Intronic
977016333 4:91696883-91696905 GCACACCTGAACTTAATGCCAGG - Intergenic
981535535 4:145795727-145795749 ACACACGTGAATCTAATGTAGGG - Intronic
981739411 4:147986274-147986296 AGACACATGAAGCTCATGGAGGG + Intronic
984060461 4:174983553-174983575 GCACATCTGACGCTAATGCCAGG - Intergenic
984356986 4:178673759-178673781 ACACACACAGAGCTAAGGCCAGG - Intergenic
987654717 5:20791929-20791951 ACACAGATGGAGCTGAAGCCTGG + Intergenic
987666481 5:20948133-20948155 ACACAAATGATGCAAATGACAGG - Intergenic
988810719 5:34782494-34782516 GCACACCTGAACTTAATGCCAGG - Intronic
989547359 5:42689997-42690019 ACAAAAATGAAAATAATGCCAGG - Intronic
990306529 5:54498934-54498956 GCACACCTGATGTTAATGCCAGG - Intergenic
990830583 5:59952436-59952458 ACACAGGTTTAGCTAATGCCAGG - Intronic
992874553 5:81040742-81040764 ACATACATCAAGCTAAAGCAGGG - Intronic
994350494 5:98739867-98739889 ATAAACATGAAACTAATGCCAGG + Intergenic
995405670 5:111792812-111792834 ACACACATAAAGCTAAGTCATGG - Intronic
996313771 5:122137956-122137978 GCACTCATAAATCTAATGCCAGG - Intronic
998801086 5:145869850-145869872 ACACATAAGAAGCTCAGGCCAGG - Intronic
1003616558 6:7659977-7659999 ACACACGTGAAGCTTTGGCCTGG - Intergenic
1004359303 6:14956679-14956701 ACACACATCAACCCAAGGCCAGG - Intergenic
1009244894 6:61224920-61224942 ACAAACAAGAAGCTAAGGGCAGG - Intergenic
1010992282 6:82492994-82493016 ACACAGATGAAGTCAATGACAGG - Intergenic
1011945113 6:92890868-92890890 ACACAGGTGAACCTAAAGCCTGG + Intergenic
1015729403 6:136333025-136333047 TTCCCCATGAAGCTAATGCCTGG - Intergenic
1017150644 6:151276370-151276392 TCAAACATGAAGCAAATTCCTGG - Intronic
1018070657 6:160161613-160161635 AAACACATCCAGCTCATGCCAGG - Intergenic
1019280341 7:196618-196640 ACACACATGAAGCTAATGCCTGG - Intronic
1024115331 7:46187478-46187500 TCACTCAGGAAGGTAATGCCTGG + Intergenic
1028092309 7:86718518-86718540 AAACACTTGAAGCTAATTGCTGG + Intronic
1029584636 7:101462610-101462632 AAATACATGAAGTTAAGGCCGGG - Intronic
1030405791 7:109111284-109111306 ACTCACGTGAAGCTGATGCCTGG + Intergenic
1031351571 7:120738301-120738323 AAACAGATGAAGCAAATGACTGG - Intronic
1031550021 7:123098519-123098541 AGACACAGAAAGCTAATGACTGG + Intergenic
1035187307 7:157136658-157136680 TCACACATGTAGCCAATGACAGG - Intergenic
1044231381 8:89782450-89782472 TCACACAGTAAGCTAATGTCAGG + Intronic
1045710703 8:104980462-104980484 AAAAACGTGAAGCTGATGCCAGG + Intronic
1048099982 8:131340806-131340828 ACACACAAGAAGATAATGCATGG + Intergenic
1049145313 8:140996482-140996504 AGAGAGATGAAGCCAATGCCTGG + Intronic
1054783259 9:69185714-69185736 ACACAAAGGAAGCTAAAGACAGG - Intronic
1056856608 9:90135104-90135126 TCACACATGTAGCGAATGCAGGG + Intergenic
1057803206 9:98202428-98202450 CCACAGCTGACGCTAATGCCTGG - Intronic
1058624662 9:106922464-106922486 ACAAACATGAAGCACATACCTGG - Intronic
1059141553 9:111857707-111857729 ACACACATGAAGCAATACCCTGG - Intergenic
1061462528 9:130751718-130751740 ACACCCATGAAGCCAGTGCCTGG + Intronic
1061463327 9:130757839-130757861 ACACACATAAAAAAAATGCCTGG - Intronic
1062680888 9:137779492-137779514 CCACACATGAAGCTGAAGGCTGG - Intronic
1062680908 9:137779569-137779591 CCACACATGAAGCTGAAGGCTGG - Intronic
1186851652 X:13585873-13585895 AACAACATGAAGCTGATGCCTGG - Intronic
1188847506 X:35091455-35091477 ACACAAAGGAAGCTATTGCTTGG - Intergenic
1193654053 X:84176698-84176720 ACACACAGCAAGCTAGTGACAGG + Intronic
1199464664 X:148122716-148122738 ACAGAAATGAAGCTAATTCCAGG - Intergenic
1199661210 X:150052787-150052809 ACAGGCATGAAGTCAATGCCTGG - Intergenic
1199848748 X:151710381-151710403 TCAGACAGGAAGCTAATGACAGG - Intergenic
1201430520 Y:13897409-13897431 ACAGAGAGGAAGCTAAGGCCTGG - Intergenic
1201700713 Y:16878582-16878604 GCACACATGACCTTAATGCCAGG + Intergenic